Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite speciﬁcity with a strong preference for small polar side chains docx

... fromQiagen (Valencia, CA). Anti-(mouse) IgG HRP conjugatewas from Promega (Madison, WI). Human a1 AT puriﬁedfrom plasma was purchased from Calbiochem (San Diego,CA) and Sigma. Recombinant human pro-enteropeptidasewas ... wild-type a1 AT in a manner that wascomparable with inhibition of cationic and anionictrypsins, demonstrating that Arg198 is the criticaldeterminant of resistance against a1 AT (Fig. 2A, B).Figure 2A ... play a role in either activation or degradation ofpancreatic protease zymogens were proven untenable,because several laboratories showed that mesotrypsin did not activate human cationic or anionic...

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

... relevantgenes. By using primers TEHA1: ACACAGATCTCTGCA-GGGCACCCCAGGCTTTACA and TEHA2: ACACCC-ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 wasampliﬁed. TEHA3: ACACAGATCTCTGCAGTGAAATG-AGCTGTTGACAATTA and ... (Bio-Rad Laborato-ries), 5 lL of cDNA template and 5 pmol of reverse(rpmE_R, GFP6_R) and forward (rpmE_F: AAGTGCCA-CCCGTTCTTCAC, GFP6_F: GACAACCACTACCTGA-GCAC) speciﬁc primers. PCR ampliﬁcation ... control (data not shown). An additional evalu-ation of the correlation between the amount of solubleand insoluble protein achieved was performed for thisdata set. A constant ratio was seen between...

Tài liệu Báo cáo khoa học: Ionic strength and magnesium affect the speciﬁcity of Escherichia coli and human 8-oxoguanine-DNA glycosylases pdf

... mixed with 1 ⁄ 2 vol. of formamide loading dye andheated again for 2 min at 95 °C. To measure the AP lyaseactivity of OGG1, the reaction was terminated by mixing with 1 ⁄ 2 vol. of formamide loading ... 3¢-phosphate(AP lyase activity) after excision of the damaged base(DNA glycosylase activity). Fpg efﬁciently catalyzesb,d-elimination at the AP site so that these reactionscannot be separated ... glycosylase and itssubstrate speciﬁcity. Proc Natl Acad Sci USA 88,4690–4694.22 Castaing B, Geiger A, Seliger H, Nehls P, Laval J,Zelwer C & Boiteux S (1993) Cleavage and binding of a DNA fragment...

Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

... GGATCCATGGTCATGGAAACATATCCATAAATCGG and CCATCCATGGTCAGTTGATAGGAGCTGTGAAGAAAAC, respectively (all incorporating NcoIsite, underlined). The resulting fragments were cloned intopEG202 using EcoRI and NcoI.The ... protein colocalizes to mitochondria with a human voltage-dependent anion channel,HVDAC3, and alters its transmembrane potential.J Virol 74, 2840–2846.23 Tanaka Y, Kanai F, Kawakami T, Tateishi ... ampliﬁcation of the appropriatehSuv3p cDNA fragments using the forward primer as incase of pEGhSUV3-380–786 and the following reverseprimers: CCATCCATGGCTAGGAAGCAAGGGACAGCTCTCC, GGATCCATGGTCATGGAAACATATCCATAAATCGG...

Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

... Yasuoka S, Onishi T, Kawano S, Tsuchihashi S, Ogaw-ara M, Masuda K, Yamaoka K, Takahashi M & SanoT (1997) Puriﬁcation, characterization, and localizationof a novel trypsin-like protease ... the human air-way. Am J Respir Cell Mol Biol 16, 300–308.2 Yamaoka K, Masuda K, Ogawa H, Takagi K, Umemo-to N & Yasuoka S (1998) Cloning and characterizationof the cDNA for human airway ... M, Nakamura Y, Takahashi A, Nakaya Y, EguchiH, Masegi T, Yoneda K, Yasuoka S & Sone S (2003)Effect of human airway trypsin-like protease onintracellular free Ca2+concentration in human...

Tài liệu Báo cáo khoa học: Puriﬁed RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf

... 5414–5418.36 Bok D, Ruiz A, Yaron O, Jahng WJ, Ray A, Xue L &Rando RR (2003) Puriﬁcation and characterization of a transmembrane domain-deleted form of lecithin retinolacyltransferase. Biochemistry ... 11-cis-retinol graduallydecreased with increasing Chaps concentrations. Whenthe Chaps-soluble fractions were used for the isomero-hydrolase assay, an initial plateau of enzymatic activitywas observed ... byNi2+–nitrilotriacetic acid afﬁnity chromatography. (A) SDS ⁄ PAGE with Coomassie Brilliant Blue staining. (B) Western blot analysis with antibody speciﬁc for RPE65. (C) Western blot analysis with antibody...

Tài liệu Báo cáo khóa học: Active-site residues and amino acid speciﬁcity of the bacterial 4¢-phosphopantothenoylcysteine synthetase CoaB pptx

... and the standard proteins used for calibration were obtained from Amersham PharmaciaBiotech.CoaB assayAs 4¢-phosphopantothenate is not commercially available,it was synthesized enzymatically ... 5¢-GCCAGTTTTGAATTCTGGAAAGCGCCTCG-3¢ and (reverse) 5¢-CGGGTCCAAGATCTTAACGTCGATTTTTTTC-3¢ as primers (introduced EcoRIand BglII sites are underlined) and the puriﬁed chromo-somal DNA as template. The ampliﬁed ... conﬁrmed for theplant PPC decarboxylase AtHAL 3a (AtCoaC) by purifyingoxidatively decarboxylated pantothenoylcysteine as a reac-tion intermediate [11] and by determining the crystalstructure of AtHAL3a...

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

... plants. NatBiotechnol 18, 666–669.36 Rosati C, Aquilani R, Dharmapuri S, Pallara P,Marusic C, Tavazza R, Bouvier F, Camara B &Giuliano G (2000) Metabolic engineering of beta-carotene and ... reveals a novel cleavage pattern,cytosolic localization and induction by highlight. MolMicrobiol 69, 231–244.41 Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J(2007) Identiﬁcation and ... Dun EA, Pillot JP, Letisse F, Matusova R, DanounS, Portais JC et al. (2008) Strigolactone inhibition ofshoot branching. Nature 455, 189–194.11 Umehara M, Hanada A, Yoshida S, Akiyama K, AriteT,...

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

... 0.4 A ˚. Signiﬁcant deviations for main- and side- chain atoms in the ligand loop contain-ing the K100 are however, observed. To accommodateK100 as a ligand a number of main-chain atoms aredisplaced ... sulfate.X-ray diffraction data of the wt and M100K crystalswere collected on an in-house beam using a MAR345Image Plate detector. The crystals were mounted in a capil-lary and datasets at ... data collec-tion and reﬁnement are summarized in Table 1. Theprogram procheck [34] was used to analyse conforma-tional variations from the deﬁned norms, with thequality of the Ramachandran...

Báo cáo khoa học: Probing plasma clearance of the thrombin–antithrombin complex with a monoclonal antibody against the putative serpin–enzyme complex receptor-binding site docx

... RCL, with attached protease, as an additional strand into b-sheet A ofthe inhibitor, causes a dramatic conformational change inthe serpin [9]. Recent X-ray crystallographic diffractionanalysis ... compete with deacylation, which leads to release of the activeprotease. Human elastase cleaves AT at Ile390 withoutcomplex formation [12]. The elastase-cleaved form hasproperties that are indistinguishable ... hexapeptide FIREVP.Several mAbs against human AT have been reported thatmap to the C-terminal region of the molecule. Asakuraet al. described a murine mAb (JITAT-16) raised to human AT that...

Xem thêm