Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
... from Qiagen (Valencia, CA). Anti-(mouse) IgG HRP conjugate was from Promega (Madison, WI). Human a1 AT purified from plasma was purchased from Calbiochem (San Diego, CA) and Sigma. Recombinant human pro-enteropeptidase was ... wild-type a1 AT in a manner that was comparable with inhibition of cationic and anionic trypsins, demonstrating that Arg198 is the critical determinant of resi...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and ... (Bio-Rad Laborato- ries), 5 lL of cDNA template and 5 pmol of reverse (rpmE_R, GFP6_R) and forward (rpmE_F: AAGTGCCA- CCCGTTCTTCAC, GFP6_F: GACAACCACTACCTGA- GCAC) specific primers. PCR amplificati...
Ngày tải lên: 06/03/2014, 01:20
Tài liệu Báo cáo khoa học: Ionic strength and magnesium affect the specificity of Escherichia coli and human 8-oxoguanine-DNA glycosylases pdf
... mixed with 1 ⁄ 2 vol. of formamide loading dye and heated again for 2 min at 95 °C. To measure the AP lyase activity of OGG1, the reaction was terminated by mixing with 1 ⁄ 2 vol. of formamide loading ... 3¢-phosphate (AP lyase activity) after excision of the damaged base (DNA glycosylase activity). Fpg efficiently catalyzes b,d-elimination at the AP site so that these reactions cannot b...
Ngày tải lên: 18/02/2014, 18:20
Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt
... GGAT CCATGGTCATGGAAACATATCCATA AATCGG and CCAT CCATGGTCAGTTGATAGGAGC TGTGAAGAAAAC, respectively (all incorporating NcoI site, underlined). The resulting fragments were cloned into pEG202 using EcoRI and NcoI. The ... protein colocalizes to mitochondria with a human voltage-dependent anion channel, HVDAC3, and alters its transmembrane potential. J Virol 74, 2840–2846. 23 Tanaka Y, Kanai...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc
... Yasuoka S, Onishi T, Kawano S, Tsuchihashi S, Ogaw- ara M, Masuda K, Yamaoka K, Takahashi M & Sano T (1997) Purification, characterization, and localization of a novel trypsin-like protease ... the human air- way. Am J Respir Cell Mol Biol 16, 300–308. 2 Yamaoka K, Masuda K, Ogawa H, Takagi K, Umemo- to N & Yasuoka S (1998) Cloning and characterization of the cDNA for human air...
Ngày tải lên: 30/03/2014, 11:20
Tài liệu Báo cáo khoa học: Purified RPE65 shows isomerohydrolase activity after reassociation with a phospholipid membrane pdf
... 5414–5418. 36 Bok D, Ruiz A, Yaron O, Jahng WJ, Ray A, Xue L & Rando RR (2003) Purification and characterization of a transmembrane domain-deleted form of lecithin retinol acyltransferase. Biochemistry ... 11-cis-retinol gradually decreased with increasing Chaps concentrations. When the Chaps-soluble fractions were used for the isomero- hydrolase assay, an initial plateau of enzyma...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khóa học: Active-site residues and amino acid specificity of the bacterial 4¢-phosphopantothenoylcysteine synthetase CoaB pptx
... and the standard proteins used for calibration were obtained from Amersham Pharmacia Biotech. CoaB assay As 4¢-phosphopantothenate is not commercially available, it was synthesized enzymatically ... 5¢-GCCAGTTTT GAATTCTGGAAAGCGC CTCG-3¢ and (reverse) 5¢-CGGGTCCA AGATCTTAA CGTCGATTTTTTTC-3¢ as primers (introduced EcoRI and BglII sites are underlined) and the purified chromo- somal DNA as temp...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... plants. Nat Biotechnol 18, 666–669. 36 Rosati C, Aquilani R, Dharmapuri S, Pallara P, Marusic C, Tavazza R, Bouvier F, Camara B & Giuliano G (2000) Metabolic engineering of beta- carotene and ... reveals a novel cleavage pattern, cytosolic localization and induction by highlight. Mol Microbiol 69, 231–244. 41 Prado-Cabrero A, Estrada AF, Al-Babili S & Avalos J (2007) Identification...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... 0.4 A ˚ . Significant deviations for main- and side- chain atoms in the ligand loop contain- ing the K100 are however, observed. To accommodate K100 as a ligand a number of main-chain atoms are displaced ... sulfate. X-ray diffraction data of the wt and M100K crystals were collected on an in-house beam using a MAR345 Image Plate detector. The crystals were mounted in a capil- lary...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Probing plasma clearance of the thrombin–antithrombin complex with a monoclonal antibody against the putative serpin–enzyme complex receptor-binding site docx
... RCL, with attached protease, as an additional strand into b-sheet A of the inhibitor, causes a dramatic conformational change in the serpin [9]. Recent X-ray crystallographic diffraction analysis ... compete with deacylation, which leads to release of the active protease. Human elastase cleaves AT at Ile390 without complex formation [12]. The elastase-cleaved form has properties tha...
Ngày tải lên: 17/03/2014, 10:20