Báo cáo khoa học: Submembraneous microtubule cytoskeleton: regulation of microtubule assembly by heterotrimeric G proteins pptx

Báo cáo khoa học: Submembraneous microtubule cytoskeleton: regulation of microtubule assembly by heterotrimeric G proteins pptx

Báo cáo khoa học: Submembraneous microtubule cytoskeleton: regulation of microtubule assembly by heterotrimeric G proteins pptx

... inhibit the exchange of GDP-bound for GTP-bound Ga [73–75]. These signal- ing partners of G proteins might also be involved in the regulation of microtubule assembly by Gia or Gbc (Fig. 3). This is ... I and II AGS proteins, each member of the group III AGS proteins (AGS2, AGS7-10) binds to Gbc but not Ga. Group II AGS proteins (AGS3 ⁄ LGN) have been studied extensive...

Ngày tải lên: 30/03/2014, 10:20

10 262 0
Báo cáo khoa học: MicroRNAs and the regulation of fibrosis potx

Báo cáo khoa học: MicroRNAs and the regulation of fibrosis potx

... fibro- blast migration by inducing caspase-3 expression. Studies using a bleomycin-induced mouse model of lung fibrosis confirmed that the up -regulation of miR-155 was correlated with the degree of lung fibrosis in ... following imperfect binding between the miRNA and the miRNA-recognition elements (MRE) within the 3¢-UTR of target genes. Specificity of the miRNA is thought to be pri...

Ngày tải lên: 15/03/2014, 11:20

7 436 0
Báo cáo khoa học: Apoptosis and autophagy: Regulation of apoptosis by DNA damage signalling – roles of p53, p73 and HIPK2 ppt

Báo cáo khoa học: Apoptosis and autophagy: Regulation of apoptosis by DNA damage signalling – roles of p53, p73 and HIPK2 ppt

... autophagy: Regulation of apoptosis by DNA damage signalling – roles of p53, p73 and HIPK2 Nadja Bitomsky and Thomas G. Hofmann German Cancer Research Center (DKFZ), Cellular Senescence Group, ... Heidelberg, Germany Introduction Protection of the genome and maintenance of genomic integrity following genotoxic stress is a crucial step in counteracting tumorigenesis. Eukaryotic org...

Ngày tải lên: 16/03/2014, 00:20

10 466 0
Báo cáo khoa học: Gonadotropin-releasing hormone: regulation of the GnRH gene pot

Báo cáo khoa học: Gonadotropin-releasing hormone: regulation of the GnRH gene pot

... few regarding regulation of the GnRH-II gene. The GnRH-I promoter Among the studies on the transcriptional regulation of GnRH genes, most have been performed on GnRH-I. The 5¢-flanking region of ... lines, GT1-7 and hGLCs [11,75,76], suggested the possible involve- ment of estrogen (E 2 ) in regulation of the GnRH-I gene. Inconsistent results have been reported regarding the r...

Ngày tải lên: 16/03/2014, 04:20

21 369 0
Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt

Báo cáo khoa học: Structure, expression and regulation of the cannabinoid receptor gene (CB1 ) in Huntington’s disease transgenic mice ppt

... ** *G* ******C*********TG *G* G** *G* *A**A******** ZF9 +145 M GCGCTCGGGGTGGCCCAAGCGGGCGG CCCCAGGCCGGCCAGCGCGGT CAGTGGGACGCCGGGGAGAGCCGGAGAA CGAAGCGGGCCTG H ****C****C****GG*GA************C**** *G* CAG****GGCTCG *G* GA****C*A*T*A******T *G* **GGGG** *G* *TC** *G* CGG ... ****C****C****GG*GA************C**** *G* CAG****GGCTCG *G* GA****C*A*T*A******T *G* **GGGG** *G* *TC** *G* CGG MZF1 WHZ...

Ngày tải lên: 16/03/2014, 18:20

12 504 0
Báo cáo khoa học: Tec family kinases: regulation of FceRI-mediated mast-cell activation ppt

Báo cáo khoa học: Tec family kinases: regulation of FceRI-mediated mast-cell activation ppt

... consti- tutes the second largest family of nonreceptor protein Fig. 1. A simplified scheme of FceRI signaling. IgE ⁄ FceRI cross-linking by antigen induces the phosphorylation of immunoreceptor tyro- sine-based ... their ability to bind IgE. Cross-linking of the IgE ⁄ FceRI complex with antigen (e .g. an allergen) causes the acti- vation of mast cells and induces a variety of eff...

Ngày tải lên: 28/03/2014, 22:21

11 310 0
Báo cáo khoa học: Wisely chosen paths – regulation of rRNA synthesis Delivered on 30 June 2010 at the 35th FEBS Congress in Gothenburg, Sweden potx

Báo cáo khoa học: Wisely chosen paths – regulation of rRNA synthesis Delivered on 30 June 2010 at the 35th FEBS Congress in Gothenburg, Sweden potx

... regulating gene expression [65,66]. Noncoding RNAs are integral components of chroma- tin, acting as key regulators of gene expression and genome stability. Although the mechanistic details of how ... promoter T 0 A C G U U G G U C C A C C C U C A G C C U U C C U C C C UCE CORE U U A G A C G C U G C U U G C G A U G G C C U (promoter-associated RNA) 150–250 nucleotides...

Ngày tải lên: 29/03/2014, 21:20

14 323 0
Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

Tài liệu Báo cáo khoa học: Seed-based systematic discovery of specific transcription factor target genes pptx

... DARSfw (5¢-ACTACGCGTAGTCCAAGAGAGGAGAAACC -3¢) and DARSrv (5¢-ACTCTCGAGCCCGGAGCGCTGGCG GCCGC-3¢), and NFKBIAfw (5¢-ACTGAGCTCCCGA CGACCCCAATTCAAATCG-3¢) and NFKBIArv (5¢-ACT GAAGCTTTGTGGGCTCTGCAGCGCCGC-3¢). The ... 5¢-ACCCGGGTCCCAGCCTCGAC-3¢; OPTN reverse, 5¢-GACAGCCAGCCGCTCCCTGC-3¢; SPI-B for- ward, 5¢-TCCAGCTCCTGTCCCATCTC-3 ¢; SPI-B reverse, 5¢-TGTCACATGGCAGGGATGGC-3¢; and CASP4 for- ward, 5¢...

Ngày tải lên: 18/02/2014, 18:20

15 500 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

... Proceedings of the 50th Annual Meeting of the Association for Computational Linguistics, pages 140–144, Jeju, Republic of Korea, 8-14 July 2012. c 2012 Association for Computational Linguistics Learning ... solution is straightfor- ward: give a smaller weight to missing words, e .g. , so that the algorithm tries to select a hypothesis with maximum value of R o − 0.01 × R m . We choos...

Ngày tải lên: 19/02/2014, 19:20

5 585 0
Tài liệu Báo cáo khoa học: "Fast and Robust Part-of-Speech Tagging Using Dynamic Model Selection" pptx

Tài liệu Báo cáo khoa học: "Fast and Robust Part-of-Speech Tagging Using Dynamic Model Selection" pptx

... using the same training data and select an appropriate model given input sentences during decoding. Each model uses a one-pass, left-to-right POS tagging algorithm. Even with the simple tagging ... bidirectional tagging algorithm has an advantage over our simple left-to-right algorithm. 4.3 Speed comparisons Tagging speeds are measured by running each sys- tem on the mixture of all data....

Ngày tải lên: 19/02/2014, 19:20

5 455 0
Từ khóa:
w