Báo cáo khoa học: Caenorhabditis elegans expresses a functional ArsA pptx
... were as follows: forward 5¢-CCG CTGCAGGAA AAAACGCTAAAATGGA-3¢ and reverse 5¢-CGC AAG CTTAGAACAAATTAGTTTAGT-3¢. The amplified PCR product was purified using a QIAquick PCR purification kit (Qiagen, ... encoding a protein of 342 amino acids and exhibits 33% identity to E. coli ArsA ATPase. A BLAST search showed that eukaryotic ArsAs from Saccharomyces cerevisiae (Arr4p), human (hASNA-I), m...
Ngày tải lên: 30/03/2014, 09:20
... Vatamaniuk OK, Bucher EA, Ward JT & Rea PA (2001) A new pathway for heavy metal detoxification in animals. Phytochelatin synthase is required for cadmium tolerance in Caenorhabditis elegans. ... zinc overload. Mol Microbiol 63, 256–269. 13 Maruyama K, Hori R, Nishihara T & Kondo M (1986) Isolation and characterization of metallothion- ein from nematode (Caenorhabditis elegans) ....
Ngày tải lên: 07/03/2014, 02:20
... pig and human DAAOs. More- over, like pig DAAO [59], Y69Ap was more active against d-Met than against d-Ala (Tables 1 and 2). In contrast, the R. gracilis and carp DAAOs are more act- ive against ... elegans. Experimental procedures Animals and chemicals Caenorhabditis elegans Bristol strain N2 and E. coli strain OP50 were kindly provided by Y. Nakagawa (Laboratory Caenorhabditis ele...
Ngày tải lên: 30/03/2014, 10:20
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... be false. Actions have a number of param- eters, as well as a precondition and effect, both of which are logical formulas. When a planner tries to apply an action, it will first create an action ... without being changed by the action. Atoms are printed in boldface iff they contradict the goal. This plan can be read as a derivation tree that has one node for each action instance in the...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "What''''s in a Semantic Network?" pptx
... representation. Several arguments have been made that frame representation languages and semantic-network languages are syntactic variants of the f~st-order predicate calculus (FOPC). The typical ... not view a subtype link as an arbitrary implication such as (1.1) and it does not view a type link as an arbitrary atomic sentence such as (1.2). In our representation language we cap...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... start codon (ATG). Primers with the fol- lowing sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis thaliana L-galac- tono-1,4-lactone dehydrogen...
Ngày tải lên: 07/03/2014, 12:20
Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx
... an interaction partner for ADAM10 that enhances a- sec- retase shedding of APP, probably by regulating matu- ration of the prodomain of ADAM10 [22]. The catalytical domain of ADAM10 contains a typical zinc-binding ... 102, 1595–1605. 106 Arduise C, Abache T, Li L, Billard M, Chabanon A, Ludwig A, Mauduit P, Boucheix C, Rubinstein E & Le NF (2008) Tetraspanins regulate ADAM10-medi- a...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... Milne TA, Copeland TD, Levine SS, Lee JC, Hayes DN, Shanmugam KS, Bhattacharjee A, Biondi CA et al. (2004) Menin associates with a trithorax family histone methyltrans- ferase complex and with ... general transcriptional co-activators that contain histone and transcription factor acetylation activities [30]. In addi- tion, CBP contains a number of protein-binding domains that mediate tra...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... showing a greater effect (29% decrease in aggregation rate) than PDI (18% decrease in rate). When 1mm bacitracin was added to the PDI-catalyzed reaction the rate of aggregation of rhodanese was significantly ... rhodanese was also decreased by bacitracin. The decrease in the noncatalyzed rate (31%) was similar to that of the PDI-catalyzed reaction (a 32% decrease). These results Fig. 1. Bac...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaeal triosephosphate isomerase adapted to high temperature. J Mol Biol 342, 861–875. 12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S, Balaram H, Balaram ... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram H, Ba...
Ngày tải lên: 18/02/2014, 11:20