Báo cáo khoa học: Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore doc

Báo cáo khoa học: Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore doc

Báo cáo khoa học: Homologous expression of a bacterial phytochrome The cyanobacterium Fremyella diplosiphon incorporates biliverdin as a genuine, functional chromophore doc

... (5¢-TATA CCATGG GCTTAAGTCCTGAAAATTCTCCAG-3¢) and oBQ147 (5¢-AAA CTCGAGCCGGCCCTCAATTTTGACCTCCTGC AATGTGAAATAGAACG-3¢), and cloned between the NcoI and XhoI sites into pET2 8a( +), providing a His-tag ... phytochrome A (CphA) and cyanobacterial phytochrome B (CphB). Cyanobacterial phytochrome A has the canonical cysteine residue, by which covalent chromophore attach- ment is a...
Ngày tải lên : 30/03/2014, 08:20
  • 11
  • 440
  • 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... nrdF + gene was sequenced by a primer walking approach. For DNA analysis, dnastar software (DNAS- TAR Inc., Madison, WI, USA) and clone manager 5.0 (Scientific & Educational Software, Cary, NC, USA) ... described as a manganese analogue [4] of the iron containing class I RNR of Escherichia coli. This assignment was based on an analysis of its metal compo- sition and similarit...
Ngày tải lên : 15/02/2014, 01:20
  • 14
  • 872
  • 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

... Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, ... scaffold proteins interact with at least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration...
Ngày tải lên : 22/03/2014, 16:20
  • 11
  • 419
  • 0
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt

... outer reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific ... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA...
Ngày tải lên : 19/02/2014, 02:20
  • 11
  • 662
  • 0
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

... 5¢- UGACUUCCCUGGCCUAUUUUU-3¢,5¢-ACAUUGAGC UCCUCUCUUGUU-3¢,5¢-GAUAAGGUUGCUUCAGU UAUU-3¢ and 5¢-ACAGUACGCUAUGAAACUAUU-3¢, respectively. As a negative control, we used an NT siRNA (5¢-UAGCGACUAAACACAUCAA-3¢) or a ... (forward, 5¢-GGCCCAG GTGACTCAGCTATT-3¢; reverse, 5¢-AGGGCATCCGA GAATTCCTT-3¢), LAMP2 (forward, 5¢-TCAGCATTGC AAATAACAATCTCA-3¢; reverse, 5¢-CAGTCTGCTCT TTGTTGCACATATAA-3¢), CT...
Ngày tải lên : 07/03/2014, 05:20
  • 16
  • 494
  • 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

... mice. Acads, acyl-coenzyme A dehydrogenase, short chain; Aco1, aconitase 1; Agt ) , alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydr- ase 3; Cat, ... results are summarized in Fig. 3A. In AgxtKO mice, kidney enolase was clearly overexpressed, as were liver fructose bisphosphatase and catalase, whereas liver enolase and carbonic anhydrase...
Ngày tải lên : 23/03/2014, 03:20
  • 9
  • 481
  • 0
Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx

... hydrolytic enzymes of primary metabolism [6,8,15]. Although the analyzed SCPL acyltransferases have maintained the nature and configuration of the Ser-His-Asp catalytic triad from hydrolases, designed ... 1-O-sinapoyl-b-glucose:choline sinapoyltransferase from Arabidopsis (AtSCT; EC 2.3.1.91) [9,10] and Brassica napus (BnSCT) [11–13], as well as 1-O-sinapoyl-b-glucose:l-malate si...
Ngày tải lên : 23/03/2014, 07:20
  • 13
  • 310
  • 0
Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot

Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot

... orthovanadate, sodium pyrophosphate, among others, and inhibits the classes of acid and alkaline phosphatases, as well as serine ⁄ threonine (PP1, PP 2A, PP2B) and tyrosine protein phosphatases. Because ... the separation of cytosolic, plasma membrane and nuclear fractions, as described above. Endogenously expressed GC -A was enriched by incubation of the combined plasma m...
Ngày tải lên : 29/03/2014, 09:20
  • 14
  • 313
  • 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... for soyasapogenol A is not as simple as that for soyasapogenol B, and the presence of additional hydroxylases must be considered. Fortunately, the aglycone of the major soyasaponins is soyasapogenol ... cerevisiae strain GIL77 Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAG GTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCA AAGGAACTCTTCT-3¢), corresponding to the N- and C-terminal sequences...
Ngày tải lên : 19/02/2014, 07:20
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

... 5¢-GGGCACTC AGCCAGGGGACATCCTGCCCAA-3¢ as forward and 5¢-GATACAAGTTTGCACACCTTTGCACTTCTG-3¢ as reverse [58]. The PCR amplification was performed in a total volume of 50 lL reaction mix containing ... was associated with increased phosphatidylserine expression in the outer leaflet of the plasma membrane and the presence of many intracellular lipid drop- lets. These data descr...
Ngày tải lên : 19/02/2014, 16:20
  • 14
  • 682
  • 0

Xem thêm