... in histological material is a valuable component of conventional histopathologi- cal analysis and may be of major prognostic import- ance [56]. Proliferation in immunohistochemical sections can ... Drosophila revealed that Cdc45 is part of a high molecular mass complex, which was shown to possess helicase activity [17,18] leading to the concept that Cdc45 is an auxili- ary fact...
Ngày tải lên: 19/02/2014, 00:20
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
... CTGTGAAAGGCGCAGCGTCCTGCCACAC EMSA S¢1 Skp1 S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S¢2 Skp1 S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S2 S: GCCTCTTTAGAAGATCAAAAGTAGG F: CTACTTTTGATCTTCTAAAGAGGC NS* ... GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC DLf del.RR S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG DLf del.KK S: GTGTGGCAGGA...
Ngày tải lên: 30/03/2014, 08:20
... general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis Airat Kayumov 1,2 , Annette Heinrich 3 , Kseniya Fedorova 2 , Olga Ilinskaya 2 and Karl ... extract, TnrA6, TnrA20 and wild-type TnrA were almost com- pletely degraded, but not TnrA35. This indicates that a Fig. 5. BIAcore analysis of GS–TnrA complex formation. (A) GS– TnrA i...
Ngày tải lên: 06/03/2014, 00:21
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase 8 and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9. Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC are tetra peptide substrates representing ... follows: caspase 1, WEHD-AMC; caspase 2, VDVAD- AMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; ca- spase 8,...
Ngày tải lên: 19/02/2014, 13:20
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt
... putative polyadenylation signals (AATAAG and AATAAC) are present about 20 nucleotides in front of the poly (A) tail (Fig. 3A) . Both are not identical to the most often used signal AAT AAA which is ... 44000 44013 CCA ATG A CGC ATG C Weak Weak >54aa 9aa 1¢ 44 68% – 2 > 53 20% 55046 TAT ATG T Weak 3 aa 2 ⁄ 4 55067 TCA ATG C Weak 58 aa 3 33 39% 60929 60933 60939 GTA ATG C TGC ATG T TC...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx
... Hill Road Palo Alto, CA 94304, USA mforst@parc.com Abstract In this paper we present a human- based evaluation of surface realisation alterna- tives. We examine the relative rankings of naturally ... suggests that, on the one hand, native speakers do accept quite some variation, but that, on the other hand, there are clearly factors that make certain realisation al- ternatives more pr...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... RNA helicase in translational repression is an RNA-mediated oligomer. Nucleic Acids Res 32, 1325– 1334. 5 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y, Nagahama Y & Yamashita M (2003) ... J & Wickens M (2004) Mammalian GLD–2 homologs are poly (A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412. 18 Nakanishi T, Kubota H, Ishibashi N, Kumagai S, Watanabe H, Yamashita M, Kashi...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx
... stromal cell-derived factor (SDF) -1alpha. Glycobiology 10, 21– 29. 34 Valenzuela-Fernandez A, Palanche T, Amara A, Mage- rus A, Altmeyer R, Delaunay T, Virelizier JL, Baleux F, Galzi JL & Arenzana-Seisdedos ... by T-cell-line-adapted HIV-1. Nature 382, 833–835. 7 Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, Virelizier JL & Arenzana-Seis- dedos F...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Cytochrome b6f is a dimeric protochlorophyll a binding complex in etioplasts doc
... indicating a structural or a functional role for both pigments. A structural role was indicated in a Chl-less mutant that was reported to lack accumulation of the Cyt b 6 f complex in Clamydomonas ... phyty- lated chlorophyll precursor protochlorophyll a, and not chlorophyll a ,is associated with subunit b 6 . The data imply that a phytylated tetrapyrrol is an essential st...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Bacterial IscU is a well folded and functional single domain protein pdf
... Bacterial IscU is a well folded and functional single domain protein Salvatore Adinolfi 1 , Francesca Rizzo 1 , Laura Masino 1 , Margie Nair 1 , Stephen R. Martin 1 , Annalisa Pastore 1 and ... here a structural characterization of this protein and demonstrate that E. coli IscU can be obtained as a recombinant well-folded protein. We demonstrate that our construct can function as...
Ngày tải lên: 23/03/2014, 12:20