Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L ) during ontogeny of cotyledons pptx

... other X-family DNA polymerases: (A) DNA poly- merase b, (B) terminal deoxynucleotidyl transferase (TdT), (C) DNA polymerase l and (D) DNA polymerase k. Analysis was carried out using the CLUSTALW sequence alignment ... anti-(rat DNA polymerase b) IgG on the activity of mungbean DNA polymerase. (A) To study the activity neutralization ability of anti-(rat DNA...

Ngày tải lên: 30/03/2014, 08:20

... lysozyme, and a- casein were from Sigma-Aldrich. Z-Arg-pNA (N-benzyloxycarbonyl-arginyl- p-nitroanilide) and Z-Gly-Pro-2-NNap (N-benzyloxycar- bonyl-glycyl-prolyl-2-naphthylamide) were from Bachem Bioscience ... role in mucosal defense against microbes by direct interaction with their membranes. Materials and methods Materials All chemicals were of the purest analytical grade available...

Ngày tải lên: 30/03/2014, 13:20

... protein as followed by SDS ⁄ PAGE (10 %). Lane 1, molecular mass markers (LMW-SDS Marker Kit from GE Healthcare), the corresponding M r values are labeled in kDa; lane 2, whole-cell lysate of E. coli ... GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCA...

Ngày tải lên: 07/03/2014, 02:20

... embedded character language models. who applied a character level distribution to the sin- gle class HMM (Brown et al., 199 2). We formu- late the character-level language model as a bigram model over ... in section 4); and 2) a character-level language model (denoted HMM+LM). In many languages morpho- logical regularities correlate strongly with a word’s part -of- speech (e.g....

Ngày tải lên: 17/03/2014, 00:20

... sequential breaking of the so-called salt bridges by C-terminal residues. Incidentally, the P is taken as an axis which is perpendicular to the dyads of both the liganded and unliganded Hb molecules. As ... various values for k f and k s into Eqn ( 2), the best fit to the experimental data was obtained as a function of time t.In these computations, the value of P was also allowed t...

Ngày tải lên: 17/03/2014, 10:20

... Sweden). All additional chemicals were obtained from Sigma (St Louis, MO, USA). Poly- sorbate-20 (Surfactant P2 0), and all additional BIAcore materials were obtained from BIAcore AB (Uppsala, Sweden). Proteins Ovalbumin ... (Uppsala, Sweden). Proteins Ovalbumin (grade V) was obtained from Sigma. Rabbit- lung TM (rl-TM) was purchased from American Diagnos- tica Inc. (Lot #97011 7A,...

Ngày tải lên: 23/03/2014, 17:21

... towards various mammalian cells; for example, in cells of A5 49 and T47D lines, IC 50 = 0.25 lgÆmL )1 and, in cells of CCL-64 and MCF 7 lines, IC 50 = 0.45 lgÆmL )1 [16]. Toxophallin preparations ... and l- methionine, l- phenylalanine, dl-norleucine, l- isoleu- cine, l- arginine, l- tyrosine, and dl-leucine; oxidase activity was relatively low towards dl-lysine and...

Ngày tải lên: 29/03/2014, 08:20

... F)amount(width(table )) c. Equative amount(length(board )) ~ amount(width(table )) d. Measurement amount(length(board )) = (50, cm) Table 1: Non-compositional approach a. Positive amount(length(board )) { 'q ... We(length(board )) b. Comparative amount(length(board )) { ~ / f-}D rl: amount(width(table )) c. Equative amount(length(board )) ~_ n x amount(width(table )) d...

Ngày tải lên: 01/04/2014, 00:20

... (MSC-200; Bio-Logic, Grenoble, France). Data acquisition and analy- sis were performed using clampex and clampfit from pclamp8 software (Molecular Devices, Sunnyvale, CA, USA). Leak and capacitive ... differ- entiation of data by simplified least squares procedures. Anal Chem 36, 1627–1639. 47 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (199 7) Gapped...

Ngày tải lên: 16/03/2014, 06:20

... BrTrp residue. Table S1. Edman degradation of Gla( 2) TxVI ⁄ A, Gla( 2) TxVI ⁄ B and Gla( 3) TxVI # . This material is available as part of the online article from http://www.blackwell-synergy.com 2788 ... carboxylase and of Gla in phyla as disparate as Chordata and Mol- lusca suggests the existence of an ancestral carboxyla- tion system with a purpose predating blood coag...

Ngày tải lên: 23/03/2014, 11:20