Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx
... Okada K, Kamiya Y, Zhu X, Tanaka K, Nakagawa T, Kawamukai M & Matsuda H (1997) Analysis of the decaprenyl diphosphate synthase (dps) gene in fission yeast suggests a role of ubiquinone as an antioxidant. ... (5¢-to3¢) COQ1- BamHI CCGGATCCCATGTTTCAAAGGTCTGGC COQ1-SmaI GCCCCCGGGTTACTTTCTTCTTGTTAGTA TAC COQ1- BamHI-TP45 CCGGATCCATGTTTCAAAGGTCTGGC COQ1-EcoRI CGAATTCTTACTTTCTTCT...
Ngày tải lên: 30/03/2014, 04:20
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx
... Stability and structural analysis of alpha-amylase from the antarctic psychrophile Alteromonas haloplanctis A2 3. Eur J Biochem 222, 441– 447. 51 Almog O, Gonzalez A, Klein D, Greenblatt HM, Braun S & ... positions and gave a root mean square deviation of 0.84–1.21 A ˚ (Table 2, Fig. 2). The structural resemblance with regard to root mean square deviation, fraction of co...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx
... would initially require a 50,000 x 50,000 array of values (or a trian- gular array of about half this size). With our current hardware, the largest array we can comfortably handle is about 100 ... they approximated this data by just looking at the nearest NP on each side of a particular NP. Roark and Charniak (1998) built on that work by actu- ally using conjunction and...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
... Russia, eastern Asia, Austra- lia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that cause important human and animal diseases ... A. Alim 1 and Kozo Fujisaki 2,3 1 Laboratory of Parasitic Diseases, National Institute of Animal Health, Ibaraki, Japan 2 National Research Centre for Protozoan Diseases, Obihiro...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... were purchased from Sigma. DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction enzyme analysis were performed by the standard methods ... 811–819. 28. Lanzetta, P .A. , Alvarez, L.J., Reinach, P.S. & Candia, O .A. (1979) An improved assay for nanomole amounts of inorganic phos- phate. Anal. Biochem. 100, 95–97. 2...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Oxidase activity of a flavin-dependent thymidylate synthase pot
... the oxidase activity of FDTS from Thermatoga maritima to probe the binding and release features of the sub- strates and products during its synthase activity. Results from steady-state and single-turnover ... experimentally. Here, we report pre- steady-state and steady-state studies on the oxidase activity of FDTS from Thermotoga maritima, and elu- cidate the binding...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc
... substrate specific- ity. P ⁄ CAF, p300 ⁄ CBP-associating factor, is a trans criptional coactivator with a variable N-terminal, a central HAT domain and a C-terminal bromodomain. Several stabilizing ... his- tone acetyltransferase domain of the human PCAF transcriptional regulator bound to coenzyme A. EMBO J 18, 3521–3532. 35 Ahmad S, Gromiha MM, Fawareh H & Sarai A (2004) AS...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Nuclear localization of human spermine oxidase isoforms – possible implications in drug response and disease etiology pptx
... primer pair 5¢-CAATC CTC GAGTATGCAAAGTTGTGAATCCAG-3¢ and 5¢-TAA T AAGCTTTGGTCCCCTGCTGGAAGAGGTC-3¢ and each cDNA in pET15b as the template. PCR products were restriction digested with XhoI and HindIII ... amount of available spermine in the cell. Localization of SMO in H157 cells Western blot analysis and quantification of nuclear and cytoplasmic protein extracts indicated that...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Bilayer localization of membrane-active peptides studied in biomimetic vesicles by visible and fluorescence spectroscopies pptx
... biomimetic membranes. The emergence of bacterial strains resistant to conventional antibiotics is a major cause of inefficient therapy and increased mortality from bacterial infection. The use of antimicrobial ... trans-membrane pore formation via a Ôbarrel-staveÕ organization [6], while a second model, denoted the Ôcarpet mechanismÕ, proposes accumulation of the amphipathi...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... Dissociation and reassociation was analysed by SDS ⁄ PAGE. Two micrograms of pro- tein were loaded on each lane and the gel was stained with silver. M, Bio-Rad 11 broad molecular mass standard (Bio-Rad ... December 2004) doi:10.1111/j.1742-4658.2004.04524.x The oxaloacetate decarboxylase Na + pumps OAD-1 and OAD-2 of Vibrio cholerae are composed of a peripheral a- subunit assoc...
Ngày tải lên: 23/03/2014, 13:20