Báo cáo khoa học: Hypoxia induces expression of a GPI-anchorless splice variant of the prion protein potx
... phenotypic anal- ysis of 300 subjects. Ann Neurol 46, 224–233. 3 Kikuchi Y, Kakeya T, Sakai A, Takatori K, Nakamura N, Matsuda H, Yamazaki T, Tanamoto K & Sawada J (2004) Propagation of a protease-resistant ... splice variant of the prion protein Yutaka Kikuchi 1 , Tomoshi Kakeya 1 , Osamu Nakajima 2 , Ayako Sakai 1 , Kikuko Ikeda 3 , Naoto Yamaguchi 3 , Takeshi Yamazak...
Ngày tải lên: 30/03/2014, 04:20
... CTCCCGGCAAGCGTAAGACAAATC 3¢-RACE LdEcR-RF1 CCGTAGGAATGAGGGCAGAGTGTGT LdUSP-RF1 GATTTGTCTTACGCTTGCCGGGAG LdEcR-RF2 CATTCATCGTCTCGTGTATTTCCAG LdUSP-RF2 GACAAGCGACAAACAGATGCC T. Ogura et al. Molting ... body (WB) at day 4 in the last larval instar, in the INT at day 0, 2, 4, 6 and 8 in the last larval instar, and in the adult male WB (#), female WB ($), testis TES and ovary (OVA), and L....
Ngày tải lên: 07/03/2014, 21:20
... states were manually annotated. The annotation was per- formed at word and phrase level, and the sentiment expressions identified in the corpus were asso- ciated to the source of the private-state, ... (Ga- napathibhotla and Liu, 2008). Our annotation scheme stands on the following assumptions: (i) the sentence is the unit of analysis, whose interpretation may require...
Ngày tải lên: 20/02/2014, 05:20
Báo cáo khoa học: "Much ado about nothing: A social network model of Russian paradigmatic gaps" ppt
... speakers. 3 The clustering of the gaps among 2nd conjugation dental stems most likely is partially a remnant of their original causes, and partially represents analogic extension of gaps along ... learning when there is weak analogical force. At the same time, the facts of Russian differ from the behavior of the model in that the Russian gaps spread to morph...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: "Finding Word Substitutions Using a Distributional Similarity Baseline and Immediate Context Overlap" potx
... characterise about the future that it is the nature of about what the that there is the effects of about how the that it was it as a that they were the effect of that they have the role of that ... the head ‘rescue’, lemma:rescue arg:ARG2 var:bank which indicates that ‘bank’ is object of the head ‘rescue’, and lemma:failing arg:ARG1 var:bank which indicates that...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: Glycolipids with nonreducing end a-mannosyl residues that have the potential to activate invariant Va19 NKT cells pptx
... structure of the hybridomas is listed on the left. NB116 and NB202 have an amino acid variation at the CDR3 region of the invariant Va19-Ja33 a chain, whereas the others have a ‘canonical’ (germline) ... a- mannosyl residues that have the potential to activate invariant Va19 NKT cells Michio Shimamura 1 , Yi-Ying Huang 1 , Naoki Okamoto 1 , Yutaka Watanabe 2 , Yoshiko Mur...
Ngày tải lên: 30/03/2014, 08:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... FEBS naya OA, Kolpakov FA et al. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res 26, 362–367. 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara ... 1162–1168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endothel...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: P25a ⁄ TPPP expression increases plasma membrane presentation of the dopamine transporter and enhances cellular sensitivity to dopamine toxicity pptx
... vials, and centrifuged for 15 min at 16 000 g and the supernatant was transferred to new vials. A fraction was retained for determination of total protein. The remainder of the supernatant was ... of DA is thought to be maintained by a regulated balance between the functional levels of plasma mem- brane DAT and vesicular VMAT-2. The protein a- synuclein (a- syn) is k...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu Báo cáo khoa học: Hypoxia-inducible factor-1a blocks differentiation of malignant gliomas pdf
... gate to discriminate aggregates. siRNA-mediated knockdown of HIF- 1a and VHL expression The DNA sequence corresponding to the targeting siRNAs is: HIF- 1a: 5¢-TCGACAAGCTTAAGAAAGA-3¢; VHL: 5¢-CCAAGACACCTCGAGAAT-3¢ ... reverse, 5¢-GACCTTCTTCTCCCGCATCATC-3¢. VEGF: forward, 5¢-ACGAAAGCGCAAGAAATCCC-3¢; and reverse, 5¢- TTAACTCAAGCTGCCTCGCC-3¢. Beta-actin: forward, 5¢-AGGCTCTTTTCCAGCCTTCCT...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: Molecular cloning, expression and characterization of protein disulfide isomerase from Conus marmoreus pdf
... reaction times, the refolding mixture was acidified and immediately analyzed by RP-HPLC. The amounts of native and linear tx 3a were calculated from their elution peak areas. The data are the average ... isomerase activity of PDI [23]. The lag time before appearance of the active RNase A indicates the oxidase activity, which corresponds to the x-intercept of the RN...
Ngày tải lên: 07/03/2014, 05:20