Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... function, including steroid and lipid metabolism. In addition, gene signaling pathway analysis has identi- fied gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also ... Journal 275 (2008) 1260–1273 ª 2008 The Authors Journal compilation ª 2008 FEBS 1273 A comparative analysis of the transcriptome and signal pathways in hepatic...

Ngày tải lên: 30/03/2014, 04:20

14 598 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... anthracyclines and the more sequence-selective bisanthracycline WP631. To gain further insight into the causes of the distinct behavior of daunorubicin and WP631, we compared the intracellular accumulation ... polyploidy and multinucleation instead of displaying signs of ÔclassicalÕ apoptosis as nuclear condensation or DNA fragmentation. The differences in the kine...

Ngày tải lên: 20/02/2014, 23:20

7 582 0
Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc

Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc

... China and Denmark, but with bad luck in Nigeria and Ger- many and reflects ambition and desire in India. Some expressions involving colors share the same meaning across many languages. For in- stance, ... for machine translation as a source of paraphrasing. Color-concept-emotion associations also have the potential to enhance human- computer inter- actions in many real...

Ngày tải lên: 22/02/2014, 02:20

9 528 0
Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... Microbiology, Post Graduate Institute of Medical Education and Research, Chandigarh, India 160012 3. Internal Medicine, Post Graduate Institute of Medical Education and Research, Chandigarh, India 160012 ... Teichoic acid and peptidoglycan are the major components of staphylococcal cell wall and they are known to induce inflammatory response in humans [29]. Antibodies a...

Ngày tải lên: 02/11/2012, 11:08

8 525 2
Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... consisting of the morphemes of the same type, and does not in itself indicate any characteristics in the frame sample. 640 On the other hand, Pf and Rf express the quantitative status of the ... morphemes of each type as a mass in terminology. So the transi- tions of Pf and Rf, with changing N, express the changes of the status of the morp...

Ngày tải lên: 20/02/2014, 18:20

7 595 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan- guage model adaptation are both examples of re-ranking. In these tasks, we assume that we have ... re-rank the candidate list using additional features which may or may not be included in the baseline model. Since the mapping from  to  by the linear model may make use...

Ngày tải lên: 08/03/2014, 02:21

8 505 0
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... descriptive, naming parts in terms of their function and relation to other parts, and also describing the status of parts and other objects in the sublanguage. Domain specific information can be used ... equipment failure messages had about one-half the number of sentences of the patient histories. 236 sen- tences in the medical domain were analyzed and 1...

Ngày tải lên: 08/03/2014, 18:20

4 516 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... RNA-binding and cleavage assays were evaluated. A RNA binding assay of the different mutants was performed using native MS, as indicated above. In all cases, the relative binding percentages of ... (kid A5 5G) PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69G(+) GTACAACACCT...

Ngày tải lên: 16/03/2014, 03:20

14 478 0
Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt

Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt

... is akin to charac- terizing a case of mayhem as a good crime: in both instances the adjective is incongruous. If, as a crowning handicap, we are asked to replace the vast capacity of the human ... Fitzgerald’s translation of the Rubaiyat is re- garded in the nature of a miracle. For the general case, it would seem that characterizing a sample of the...

Ngày tải lên: 16/03/2014, 19:20

18 701 0
Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

... variety of thematic roles. Zapirain et al. (2008) evaluated PropBank ARG tags and VerbNetthematic roles in a state -of- the- art SRL system, and concluded that PropBank ARG tags achieved a more ... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 19–27, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP A Compara...

Ngày tải lên: 17/03/2014, 01:20

9 550 0
w