0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

... function, including steroid and lipid metabolism. In addition, gene signaling pathway analysis has identi-fied gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also ... Journal 275 (2008) 1260–1273 ª 2008 The Authors Journal compilation ª 2008 FEBS 1273 A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal ... grade;TaKaRa, Kyoto, Japan).Microarray analysis and data mining (Aligentarray) A one-color microarray-based gene expression analysis sys-tem (Agilent Technologies, Tokyo, Japan) containing41...
  • 14
  • 597
  • 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... anthracyclines and the more sequence-selectivebisanthracycline WP631. To gain further insight into the causes of the distinct behavior of daunorubicin and WP631,we compared the intracellular accumulation ... polyploidy and multinucleation instead of displaying signs of ÔclassicalÕ apoptosis as nuclearcondensation or DNA fragmentation. The differences in the kinetics of daunorubicin and WP631 uptake are ... field of cells obtained under the samemagnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline as uniquefluorophore in the microscopic assay. WP631...
  • 7
  • 581
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Lexicon for Exploring Color, Concept and Emotion Associations in Language" doc

... China and Denmark, but with bad luck in Nigeria and Ger-many and reflects ambition and desire in India.Some expressions involving colors share the same meaning across many languages. For in- stance, ... for machine translationas a source of paraphrasing.Color-concept-emotion associations also have the potential to enhance human- computer inter-actions in many real- and virtual-world domains,e.g., ... the tra-ditions and beliefs of a society. As shown in (Sable and Akcay, 2010) green represents danger in Malaysia, envy in Belgium, love and happiness in Japan; red is associated with luck in...
  • 9
  • 527
  • 0
Báo cáo y học:

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... Microbiology, Post Graduate Institute of Medical Education and Research, Chandigarh, India 160012 3. Internal Medicine, Post Graduate Institute of Medical Education and Research, Chandigarh, India 160012 ... Teichoic acid and peptidoglycan are the major components of staphylococcal cell wall and they are known to induce inflammatory response in humans [29]. Antibodies against PG and TA antigens have ... syndrome in humans [14]. The data regarding the presence of antibodies during superficial S. aureus infections are not evaluated systematically. In this study we therefore aimed at analyzing antibody...
  • 8
  • 524
  • 2
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Statistical Analysis of Morphemes in Japanese Terminology" docx

... consisting of the morphemes of the same type, and does not in itself indicate any characteristics in the frame sample. 640 On the other hand, Pf and Rf express the quantitative status of the ... morphemes of each type as a mass in terminology. So the transi- tions of Pf and Rf, with changing N, express the changes of the status of the morphemes of each type in the terminology. In terminology, ... kyo@rd.nacsis.ac.jp Abstract In this paper I will report the result of a quan- titative analysis of the dynamics of the con- stituent elements of Japanese terminology. In Japanese technical terms, the...
  • 7
  • 594
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan-guage model adaptation are both examples of re-ranking. In these tasks, we assume that we have ... re-rank the candidate list using additional features which may or may not be included in the baseline model. Since the mapping from  to  by the linear model may make use of arbitrary global ... first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task. Then we apply the best of these estimators to two additional...
  • 8
  • 504
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx

... descriptive, naming parts in terms of their function and relation to other parts, and also describing the status of parts and other objects in the sublanguage. Domain specific information can be used ... equipment failure messages had about one-half the number of sentences of the patient histories. 236 sen- tences in the medical domain were analyzed and 123 in the Navy domain. The statistics are ... A Computational Analysis of Complex Noun Phrmms in N,,vy Messages Elaine Marsh Navy Center for Applied Research in Artificial Intelligence Naval Research Laboratory - Code 7510 Washington,...
  • 4
  • 515
  • 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... RNA-binding and cleavage assays were evaluated. A RNA binding assay of the different mutants wasperformed using native MS, as indicated above. In allcases, the relative binding percentages of ... (kid A5 5G)PA55G(+) GACACCGCAAAGCCGCCAGTGCGGGCAAA Change GGC–GCC in A5 5 (kid A5 5G)PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G)PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change ... TTGTACGTTGCGAACAACCCCGGACAAT Change GAT–GAA in D75 (kid D75E)PD75E(+) ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E)PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid...
  • 14
  • 477
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt

... is akin to charac- terizing a case of mayhem as a good crime: in both instances the adjective is incongruous. If, as a crowning handicap, we are asked to replace the vast capacity of the human ... Fitzgerald’s translation of the Rubaiyat is re- garded in the nature of a miracle. For the general case, it would seem that characterizing a sample of the translator’s art as a good translation ... indicated by the failure signal and by the notations of the error types encountered. On the other hand, the satisfaction of the criteria is no guar- antee that the result is a faithful translation,...
  • 18
  • 701
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

... variety of thematicroles. Zapirain et al. (2008) evaluated PropBankARG tags and VerbNetthematic roles in a state -of- the- art SRL system, and concluded that PropBankARG tags achieved a more ... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 19–27,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP A Comparative Study on Generalization of ... seman-tic representations, SRL has attracted much at-tention from researchers into various NLP appli-cations including question answering (Narayanan and Harabagiu, 2004; Shen and Lapata, 2007;buy.v...
  • 9
  • 549
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM