Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... 2007 The Authors Journal compilation ª 2007 FEBS Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates Anja C. V. Larsen 1 , Anne-Katrine Kvissel 1,2 , ... were expressed in human and Rhesus monkey brain. Transient expression and characterization of the CbD4 variants demonstrated that they are...
Ngày tải lên: 30/03/2014, 04:20
... [ 15 N]-labelled amino acids. The most abundant amino acids are labelled in only one of the samples, while the least abundant amino acids are labelled in up to three of the samples. The pattern of occurrence ... average amino acid abundance in proteins according to the NCBI database. Fig. 2. 15 N-HSQC spectra of five combinatorially 15 N-labelled sam- ples of t...
Ngày tải lên: 07/03/2014, 12:20
... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAA...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: "LOGICAL FORMS IN THE CORE LANGUAGE ENGINE" docx
... One-Anaphora. The a_ form construct is also used for the QLF representation of 'one-anaphora'. The variable bound by the a_ form has the type of a one place predi- cate rather than a ... technique of comparing pairs allows us to treat combinations of ordinals and su- perlatives, as in the third tallest man smiled: quant(ref (the, ), a, Man (a) A...
Ngày tải lên: 24/03/2014, 02:20
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt
... myokinase, enolase, lactate dehydrogenase, and glutamate dehydrogenase from Oriental Yeast, Osaka, Japan. Other analytical methods The N-terminal amino-acid sequence of the enzyme was determined ... Toyobo (Osaka, Japan), and New England Biolabs (Beverly, MA, USA). All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka,...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Dạy trích đoạn tiểu thuyết tự truyện của M.Gorki theo thi pháp thể loại ppt
...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Competition between neighboring topogenic signals during membrane protein insertion into the ER pptx
... (bottom). The translation initiation inhibitor aurintricarboxylic acid was added to the translation mix 1.5 min after addition of the mRNA, and Triton X-100 was then added at the indicated times. The ... site as a reporter for the trans- location of an N-tail across the ER membrane have shown that targeting to the ER is rapid, and that the factors determining the ove...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx
... layer. Repeated binding of AFP to the prism plane and the generation of a smaller ice nucleus cause successive stacking of hexagonal ice plates on the basal plane, leading to the formation of an ice ... expansion) rate was decelerated by incre- asing the protein concentration and accelerated by lowering the annealing temperature. The crystal expansion was observed ev...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Coiled–coil interactions modulate multimerization, mitochondrial binding and kinase activity of myotonic dystrophy protein kinase splice isoforms pptx
... shown in Fig. 4A, both trunca- tion mutants containing the coiled-coil domain copre- cipitated with HA-DMPK E(K10 0A) , a kinase -inactive variant impaired in ATP binding owing to a lysine to alanine ... mutation in the kinase domain [5]. DMPK splice isoforms are expressed in a cell-type- specific manner. The main isoforms in skeletal muscle, Fig. 2. Myotonic dys...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt
... simple paragraph-based approach intended as a baseline, two word-based approaches, and two coherence-based approaches. In the paragraph-based approach, sentences in the beginning of paragraphs ... evaluated the MSWord summarizer. 2 Approaches to sentence ranking 2.1 Paragraph-based approach Sentences at the beginning of a paragraph are usually more important th...
Ngày tải lên: 17/03/2014, 06:20