Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx

Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx

Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx

... Journal 274 (2007) 4951–4961 ª 2007 The Authors Journal compilation ª 2007 FEBS 4961 MINIREVIEW Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity ... Pyrimethamine, an antimalarial drug with well documented pharmacokinetics, was confirmed as a b-hexosaminidase pharmacological chaperone and compared favor...

Ngày tải lên: 30/03/2014, 03:20

11 348 0
Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane affinity and hyper-anticoagulant activity in mouse plasma pptx

... binding characteristics and hyper- anticoagulant activity. Binding ability was established using a SPR membrane binding assay and anticoagu- lant activity was assessed by a thrombin generation assay. ... plasma remains unknown but may be a result of rat FVa ⁄ FVIIIa being poor substrates for human APC [21]. APC variants with enhanced anticoagulant activity resulting from improved...

Ngày tải lên: 18/02/2014, 06:20

17 496 0
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

... CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAA PrP C RNAi2 Sense TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT Antisense CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCAC Akt RNAi Sense TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTT Antisense ... CCCAAGCTTGGGATGGCGAACCTTGGCTGCT Antisense CGGGATCCTCCCACATCAGGAAGATGAGGA PrP C RNAi1 Sense TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTT...

Ngày tải lên: 07/03/2014, 03:20

10 448 0
Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx

Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx

... microsomal lyso-PAF AT activity of human cortex and medulla As shown in Fig. 3, a plateau of maximum activity, for both cortical and medullary lyso-PAF ATs, was observed for BSA concentrations ranging ... routinely used for the determination of lyso-PAF AT activity [30]. Both cortical and medullary lyso-PAF AT activities share similar biochemical characteristics indicating tha...

Ngày tải lên: 17/03/2014, 03:20

9 324 0
Báo cáo khoa học: Curcumin suppresses the dynamic instability of microtubules, activates the mitotic checkpoint and induces apoptosis in MCF-7 cells ppt

Báo cáo khoa học: Curcumin suppresses the dynamic instability of microtubules, activates the mitotic checkpoint and induces apoptosis in MCF-7 cells ppt

... curcumin increased the accumulation of Mad2 and BubR1 at the kinetochores, indi- cating that it activated the mitotic checkpoint. In addition, curcumin treat- ment increased the metaphase ⁄ anaphase ... curcumin caused a delay in mitosis, it might lead to an increase in the metaphase ⁄ anaphase ratio. The metaphase ⁄ anaphase ratio was calculated to be 0.43 ± 0.06 and 1.88 ± 0.40 (P...

Ngày tải lên: 23/03/2014, 03:20

12 372 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... protein kinase 1 (DAPK-1) is a Ca 2+ ⁄ calmodulin-regulated serine ⁄ threonine kinase composed of multiple functional domains, including a kinase domain, a calmodulin-binding domain, eight ankyrin ... glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma...

Ngày tải lên: 18/02/2014, 17:20

11 659 0
Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

... enzymes that convert nitriles to the corresponding carboxylic acids and ammonia. They belong to a superfamily [1] that includes amidases, acyl transferases and N-carbamoyl- d-amino acid amidohydrolases, ... forming and maintaining the helix, and suggest that oligomerization utilizing these or similar interactions may be common among microbial nitrilases, cyanide dihydratases and cyani...

Ngày tải lên: 19/02/2014, 00:20

10 451 0
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx

Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx

... active site of RTA in an open conformation is not included in this study as, although several favourable interactions between the hexanucelotide and RTA are maintained, many additional interactions ... Table 1. Assay of the N -glycosidase activity of ricin A chain variants The activity of each of the RTA variants was determined by assessing their ability to depurinate 26S rRNA of Ta...

Ngày tải lên: 19/02/2014, 12:20

10 617 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... solution at pH 7.0: indigo tetrasulfonate, indigo trisulfonate, indigo disulfonate, anthraquinone-2-7-disulfonate, anthraquinone- 2-sulfonate, safranine O, diquat, neutral red, phenosafranine, and ... of pairwise interactions in a multicentre protein has been explored when forming a complex, and these interactions also show small modifications relative to the isolated protein, indicating...

Ngày tải lên: 19/02/2014, 17:20

10 640 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt

... frag- ments containing a complete x-5 gliadin gene, oligonucleo- tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, were constructed based on fragment DNA ... Foster City, CA, USA). Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC AACAATCA-3¢) and antisense (5¢-TCTCGGATCCTCA TAGGCCACTGATACTTATAACGTCGCTCCC-3¢) .....

Ngày tải lên: 20/02/2014, 01:20

8 484 0
w