Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt
... Myocyte enhancer factor 2B is involved in the inducible
expression of NOX1
⁄
NADPH oxidase, a vascular
superoxide-producing enzyme
Masato Katsuyama*, Muhammer Ozgur Cevik*, Noriaki Arakawa, ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy-
agishi M, Taira K & Yabe-Nishimura C (2005) Essen-
tial role of ATF-1 in induction of NOX1, a catalytic
su...
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... Recent advances in understanding
the mechanisms of TCDD immunotoxicity. Int Immuno-
pharmacol 2, 277–291.
2 Kamath AB, Camacho I, Nagarkatti PS & Nagarkatti
M (1999) Role of Fas–Fas ligand interactions ... CO
2
.
Apoptosis assay by determination of acetyl-
Asp-Glu-Val-Asp ⁄ 7-amino-4-methylcoumarin
(AcDEVD-AMC) cleavage
Throughout the study we used the detection of caspase...
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... cells
throughout the brain lobes and at the midline in the
subesophageal ganglion (SG) (Fig. 1A) . The axons
emanating from the somata of the two pairs of lateral
cells extend towards the pars intercerebral ... MADS box at
their N-termini and within an adjacent 29-amino-acid
region referred to as the MEF2 domain. The MADS
box is essential for DNA binding and dimeriza...
Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx
... grammar, in which the subtrees are specified
in advance, in an adaptor grammar the subtrees, as
well as their probabilities, are learnt from the train-
ing data. In order to make parsing and inference
tractable ... repeatedly drawing
a ball at random from the urn and then returning it
plus an additional ball of the same color to the urn.
In an adaptor grammar there i...
Báo cáo khoa học: "Some Comments on Algorithm and Grammar in the Automatic Parsing of Natural Languages" ppt
...
of the frequently repeated contention that the tripartite
approach, consisting in the separation of algorithm and
grammar, is particularly desirable in automatic-parsing
programs. This examination ... at the outset that in this author’s
opinion the aim of the automatic-parsing component
of a machine-translation program is the adequate
recognition of t...
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx
... conditions. The N-terminal amino acid
sequence of the 30 kDa product was Val-Val-Gly-Gly-
His. Therefore, this 30 kDa band was in fact the b
chain of mature MSP, and HGFA cleaved pro-MSP at
the normal ... dose-dependent manner. Immunoblot analysis
using an anti-MSP IgG revealed a band of approxi-
mately 60 kDa, presumably the a chain of mature
MSP (Fig. 1A) . Generatio...
Tài liệu Báo cáo khoa học: Oxidized elafin and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf
... breathing,
where inhalation of micro-organisms and air pollutants
always takes place. These proteins include a
1
-protein-
ase inhibitor (also called a
1
-antitrypsin; a 53-kDa pro-
tein that inhibits the above ... Pr3-mediated proteolysis of insol-
uble extracellular matrix proteins, such as elastin, col-
lagen, fibronectin and laminin? We have shown that
the main effect of in...
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc
... (CAGGACAGCCTGCGCAACGAG), RVR (CAG
GACAGGGTGCGCAACGAG), SVR (CAGGACAG
CGTGCGCAACGAG) and SLC (AGGGTATCCCTC
TGCGATACG), respectively. All the alleles were inserted
in pCW between the NdeIandXbaI ... assess the stability of the CYP 6A2 wt and mutant
enzymes, we measured the apoenzyme and the holoenzyme
amount for each one of them. The CYP 6A2 apoenzyme
amount in each sample...
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx
... Committee.
Acetylcholine, atropine, concanavalin A, CCK-8 and
CCK-8-NS were obtained from Sigma-Aldrich. Alamar blue
was obtained from Astral Scientific (Caringbar, New South
Wales, Australia).
Guinea pigs weighing approximately ... pro-
cessing intermediates. Am J Physiol 252, G315–G319.
39 Anastasi A, Erspamer V & Endean R (1968) Isolation
and amino acid sequence of caerulein, the...
Tài liệu Báo cáo khoa học: FGF-2, IL-1b and TGF-b regulate fibroblast expression of S100A8 doc
... pathological changes, including apoptosis
and accumulation of ECM, in some forms of cataract
[60]. The pattern of S10 0A8 gene regulation indicates
that this protein may be involved in fibroblast-to-myo-
fibroblast ... the S100 family of Ca
2+
-
binding proteins and are now accepted as markers of in ammation. They are
expressed by keratinocytes and in ammatory cells in h...