Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... Myocyte enhancer factor 2B is involved in the inducible expression of NOX1 ⁄ NADPH oxidase, a vascular superoxide-producing enzyme Masato Katsuyama*, Muhammer Ozgur Cevik*, Noriaki Arakawa, ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy- agishi M, Taira K & Yabe-Nishimura C (2005) Essen- tial role of ATF-1 in induction of NOX1, a catalytic su...

Ngày tải lên: 30/03/2014, 03:20

9 452 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

... Recent advances in understanding the mechanisms of TCDD immunotoxicity. Int Immuno- pharmacol 2, 277–291. 2 Kamath AB, Camacho I, Nagarkatti PS & Nagarkatti M (1999) Role of Fas–Fas ligand interactions ... CO 2 . Apoptosis assay by determination of acetyl- Asp-Glu-Val-Asp ⁄ 7-amino-4-methylcoumarin (AcDEVD-AMC) cleavage Throughout the study we used the detection of caspase...

Ngày tải lên: 23/03/2014, 13:20

13 426 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

... cells throughout the brain lobes and at the midline in the subesophageal ganglion (SG) (Fig. 1A) . The axons emanating from the somata of the two pairs of lateral cells extend towards the pars intercerebral ... MADS box at their N-termini and within an adjacent 29-amino-acid region referred to as the MEF2 domain. The MADS box is essential for DNA binding and dimeriza...

Ngày tải lên: 30/03/2014, 20:20

10 437 0
Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx

Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx

... grammar, in which the subtrees are specified in advance, in an adaptor grammar the subtrees, as well as their probabilities, are learnt from the train- ing data. In order to make parsing and inference tractable ... repeatedly drawing a ball at random from the urn and then returning it plus an additional ball of the same color to the urn. In an adaptor grammar there i...

Ngày tải lên: 20/02/2014, 09:20

9 644 0
Báo cáo khoa học: "Some Comments on Algorithm and Grammar in the Automatic Parsing of Natural Languages" ppt

Báo cáo khoa học: "Some Comments on Algorithm and Grammar in the Automatic Parsing of Natural Languages" ppt

... of the frequently repeated contention that the tripartite approach, consisting in the separation of algorithm and grammar, is particularly desirable in automatic-parsing programs. This examination ... at the outset that in this author’s opinion the aim of the automatic-parsing component of a machine-translation program is the adequate recognition of t...

Ngày tải lên: 07/03/2014, 18:20

2 420 0
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx

Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx

... conditions. The N-terminal amino acid sequence of the 30 kDa product was Val-Val-Gly-Gly- His. Therefore, this 30 kDa band was in fact the b chain of mature MSP, and HGFA cleaved pro-MSP at the normal ... dose-dependent manner. Immunoblot analysis using an anti-MSP IgG revealed a band of approxi- mately 60 kDa, presumably the a chain of mature MSP (Fig. 1A) . Generatio...

Ngày tải lên: 29/03/2014, 23:20

10 367 0
Tài liệu Báo cáo khoa học: Oxidized elafin and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf

Tài liệu Báo cáo khoa học: Oxidized elafin and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf

... breathing, where inhalation of micro-organisms and air pollutants always takes place. These proteins include a 1 -protein- ase inhibitor (also called a 1 -antitrypsin; a 53-kDa pro- tein that inhibits the above ... Pr3-mediated proteolysis of insol- uble extracellular matrix proteins, such as elastin, col- lagen, fibronectin and laminin? We have shown that the main effect of in...

Ngày tải lên: 19/02/2014, 07:20

11 548 0
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... (CAGGACAGCCTGCGCAACGAG), RVR (CAG GACAGGGTGCGCAACGAG), SVR (CAGGACAG CGTGCGCAACGAG) and SLC (AGGGTATCCCTC TGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... assess the stability of the CYP 6A2 wt and mutant enzymes, we measured the apoenzyme and the holoenzyme amount for each one of them. The CYP 6A2 apoenzyme amount in each sample...

Ngày tải lên: 19/02/2014, 12:20

8 535 0
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... Committee. Acetylcholine, atropine, concanavalin A, CCK-8 and CCK-8-NS were obtained from Sigma-Aldrich. Alamar blue was obtained from Astral Scientific (Caringbar, New South Wales, Australia). Guinea pigs weighing approximately ... pro- cessing intermediates. Am J Physiol 252, G315–G319. 39 Anastasi A, Erspamer V & Endean R (1968) Isolation and amino acid sequence of caerulein, the...

Ngày tải lên: 19/02/2014, 16:20

11 638 0
Tài liệu Báo cáo khoa học: FGF-2, IL-1b and TGF-b regulate fibroblast expression of S100A8 doc

Tài liệu Báo cáo khoa học: FGF-2, IL-1b and TGF-b regulate fibroblast expression of S100A8 doc

... pathological changes, including apoptosis and accumulation of ECM, in some forms of cataract [60]. The pattern of S10 0A8 gene regulation indicates that this protein may be involved in fibroblast-to-myo- fibroblast ... the S100 family of Ca 2+ - binding proteins and are now accepted as markers of in ammation. They are expressed by keratinocytes and in ammatory cells in h...

Ngày tải lên: 19/02/2014, 18:20

17 521 0
w