Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc

... Anti -arthritis effects of vitamin K2 (menaquinone- 4) ) a new potential therapeutic strategy for rheumatoid arthritis Hiroshi Okamoto, Kumi Shidara, Daisuke Hoshi and Naoyuki KamataniInstitute ... conducted a caspase activity assay. MK-4activated caspase assay in a dose-dependent manner(Fig. 2C). By contrast, vitamin K1did not show any effects on caspase activity and DNA fragmentation(data ... unsaturated side chain [1]. Vitamin K2acts as a cofactor for a vitamin K-dependent carboxylase involved in the carboxylation of coagulation factors and is an essential substrate for blood coagulation...

Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

... by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 199 8). Then, a genus word for a head word, ... Semantic Analysis of Japanese Noun Phrases : A New Approach to Dictionary-Based Understanding Sadao Kurohashi and Yasuyuki Sakai Graduate School of Informatics, Kyoto University Yoshida-honmachi, ... number of studies have been made. For example, the case grammar theory is a semantic valence theory that describes the logical form of a sentence in terms of a predicate and a series of case-labeled...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... interface mutation oncatalytic activity of triosephosphate isomeraseThe role of conserved residues and complementary mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 ... Ravindra G & Balaram P (200 5) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 281–289.20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... (BrukerDaltonics) coupled to an online 1100 series HPLC (AgilentTechnologies, Santa Clara, CA, USA). Nebulization wasassisted by N2gas (99.8 %) at a ﬂow rate of 10 LÆmin )1 . Thespray chamber was...

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

... thymus (fraction B: a mix-ture of histones H3 and H 4) displayed potent bacterici-dal activity mainly against Gram-negative bacteria, aneffect that was ampliﬁed by acid media, whereas a lysine-rich ... Yonehara S &Matsuzaki K (200 3) Translocation of analogues of theantimicrobial peptides magainin and buforinacross human cell membranes. J Biol Chem 278,1310–1315.35 Willmott CJR & Maxwell ... H4-(86–10 0) and some related compounds (30 lg) against B. subtilis in the radialdiffusion assay. Samples were applied to paper disks and placed onto an agarose plate inoculated with bacteria as described...

Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt

... its ability to be a potent suppressor of Myctransformation activity in the rat embryo ﬁbroblast(REF) assay, a surrogate assay for neoplastic transfor-mation [10]. Interestingly, a naturally ... contre le Cancer (ARC) (to TG). CDD is a recipient of postdoctoral awards from the InternationalAgency for Research on Cancer, the National CancerCenter and from ARC. Support from the AlbertEinstein ... transformation that we observed in theREF assay (Fig. 1). A very analogous scenario has beendescribed recently for isoforms of the Wilms’ tumorgene WT1. A newly identiﬁed WT1 isoform (WT1s)...

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... S inica, Taipei, TaiwanVolvatoxin A (VVA) has been isolated from Volvari-ella volvacea, and consists of volvatoxin A2 (VVA 2) and volvatoxin A1 (VVA 1) [1]. VVA has several biolo-gical activities, ... Characteristics of volvatoxin A1 (VVA 1) structure. (A) Alignment of the deduced amino acid sequence of VVA1 N-terminal domain(VVA1-NTD) and VVA1 C-terminal domain (VVA1-CTD) with that of VVA2 ... PAGE.Fig. S4. Anti-volvatoxin A2 (VVA 2) IgG. VVA2 andvolvatoxin A1 (VVA 1) were analyzed by 10%SDS ⁄ PAGE, followed by western blots and anti-VVA2IgG.This material is available as part of...

Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx

... (5¢-TAGTTCCCCGGGGGTGAAGCTGAAGTTTCTCTGACCGGTCAGCCGTTC-3 ) and reverseprimer tsf-DOWNS (5¢-AGTCAGGATCCGTCGACAGAGCTTCGCCACTCAACTTAAGCAGAA-3 ). Likeprimer Ts185, Ts224 contains a unique AvaI restriction site(underlined) and part of a sequence ... 243–24 8) [28], was inserted as alinker (Figs 1 and 2). Chromosomal DNA from E. coli strain UY211 (ara,D(lac-pro), nalA, thi) [32] was isolated and used as a templatein two separate PCR reactions ... ensure a satisfactory frequency of homologous recombination for the gene replacement. Theupstream fragment was prepared using forward primer tsf-UPS (5¢-ATGCGGGATCCAAGCTTGAGCTTACATCAGTAAGTGACCGGGATGA-3¢)...

Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx

... 10 )6 M(** *); dexamethaso ne a t 1 0 )8 M(* *), 10 )7 M(** *), 10 )6 M(** *) and 10 )5 M(** *); and RU486 at10 )6 ( *) and 10 )5 (** *). (A) (lower panel) Budesonide and dexamethasone at 10 )7 (** *), ... RU486 at 1 0 )7 M(* *), 10 )6 M(* *) and10 )5 M(** *); dexamethasone + RU486 at 10 )7 M(* *), 10 )6 Mand 10 )5 M(** *). (D) Budesonide + RU486 at 10 )6 M(* *), and 10 )5 M(* *); dexamethas one ... at10 )8 M( *), 10 )7 M(* *) and 10 )6 M(* *); dexamethasone at 10 )7 M(* *), 10 )6 M(** *) and 10 )5 M(** *); and RU486 at 10 )5 M(* *). (B) 6jBtkreporter cells, were treated with dexamethasone...

Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx

... CCTGATACGTCTTGGTCTTCATCABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACATABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA CTCCAGATAACTCCACCAGACGGABCC11 3025–3560 CCACGGCCCTGCACAACAAG GGAATTGCCAAAAGCCACGAACA100000100001000100101MRP1-HEK293 ... Position of primer Forward oligo sequence Reverse oligo sequenceABCB1 834–1086 GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGCABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATCABCC4 ... B. Hladky1, Suresh V. Ambudkar2and Margery A. Barrand11 Department of Pharmacology, University of Cambridge, UK2 Laboratory of Cell Biology, Centre for Cancer Research, National Cancer...

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... Wakatsuki S, Hatsuzawa K, Black RA,Wada I & Sehara-Fujisawa A (200 7) Meltrin beta(ADAM1 9) mediates ectodomain shedding of Neuregu-lin beta1 in the Golgi apparatus: ﬂuorescence correla-tion ... NRG-Glyc _for NRG-TM_revCCACAGAAGGAGCAAATACTTCGTTTTGCAGTAGGCCACCAC339Kringle (type II) NRG-Kringle _for NRG-Kringle_revAGGAGGAGGAGTGGTGCTGGTCCCCAGCAGCAGCAGTA239Cysteine rich domain (type III) ... NRG-CRD _for NRG-CRD_revGAGGTGAGCCGATGGAGATTTACCTCTCAGGCGCTCAGCTTC219 a NRG-5¢ _for NRG -a_ revTCTCCGGCGAGATGTCCGAGCTCCAGTGAATCCAGGTTG668b NRG-5¢ _for NRG-Beta_revTCTCCGGCGAGATGTCCGAGGCAGCGATCACCAGTAAAC677GAPDH...

Xem thêm