Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc
... Anti -arthritis effects of vitamin K 2 (menaquinone- 4) ) a new potential therapeutic strategy for rheumatoid arthritis Hiroshi Okamoto, Kumi Shidara, Daisuke Hoshi and Naoyuki Kamatani Institute ... conducted a caspase activity assay. MK-4 activated caspase assay in a dose-dependent manner (Fig. 2C). By contrast, vitamin K 1 did not show any effects...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
... by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 199 8). Then, a genus word for a head word, ... Semantic Analysis of Japanese Noun Phrases : A New Approach to Dictionary-Based Understanding Sadao Kurohashi and Yasuyuki Sakai Graduate School of Informatics, Kyoto Universi...
Ngày tải lên: 08/03/2014, 06:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 ... Ravindra G & Balaram P (200 5) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt
... thymus (fraction B: a mix- ture of histones H3 and H 4) displayed potent bacterici- dal activity mainly against Gram-negative bacteria, an effect that was amplified by acid media, whereas a lysine-rich ... Yonehara S & Matsuzaki K (200 3) Translocation of analogues of the antimicrobial peptides magainin and buforin across human cell membranes. J Biol Chem 278, 1310–1315. 35...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... its ability to be a potent suppressor of Myc transformation activity in the rat embryo fibroblast (REF) assay, a surrogate assay for neoplastic transfor- mation [10]. Interestingly, a naturally ... contre le Cancer (ARC) (to TG). CDD is a recipient of postdoctoral awards from the International Agency for Research on Cancer, the National Cancer Center and from ARC. Support from...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc
... S inica, Taipei, Taiwan Volvatoxin A (VVA) has been isolated from Volvari- ella volvacea, and consists of volvatoxin A2 (VVA 2) and volvatoxin A1 (VVA 1) [1]. VVA has several biolo- gical activities, ... Characteristics of volvatoxin A1 (VVA 1) structure. (A) Alignment of the deduced amino acid sequence of VVA1 N-terminal domain (VVA1-NTD) and VVA1 C-terminal domain (VVA...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... (5¢-TAGTTC CCCGGGGGTGAAGCTGA AGTTTCTCTGACCGGTCAGCCGTTC-3 ) and reverse primer tsf-DOWNS (5¢-AGTCA GGATCCGTCGACA GAGCTTCGCCACTCAACTTAAGCAGAA-3 ). Like primer Ts185, Ts224 contains a unique AvaI restriction site (underlined) and part of a sequence ... 243–24 8) [28], was inserted as alinker (Figs 1 and 2). Chromosomal DNA from E. coli strain UY211 (ara, D(lac-pro), nalA, thi) [...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx
... 10 )6 M (** *); dexamethaso ne a t 1 0 )8 M (* *), 10 )7 M (** *), 10 )6 M (** *) and 10 )5 M (** *); and RU486 at 10 )6 ( *) and 10 )5 (** *). (A) (lower panel) Budesonide and dexamethasone at 10 )7 (** *), ... RU486 at 1 0 )7 M (* *), 10 )6 M (* *) and 10 )5 M (** *); dexamethasone + RU486 at 10 )7 M (* *), 10 )6...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Modulatory effects of plant phenols on human multidrug-resistance proteins 1, 4 and 5 (ABCC1, 4 and 5) potx
... CCTGATACGTCTTGGTCTTCATC ABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACAT ABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA CTCCAGATAACTCCACCAGACGG ABCC11 3025–3560 CCACGGCCCTGCACAACAAG GGAATTGCCAAAAGCCACGAACA 100000 10000 1000 100 10 1 MRP1-HEK293 ... Position of primer Forward oligo sequence Reverse oligo sequence ABCB1 834–1086 GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGC ABCC1 1119–16...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... Wakatsuki S, Hatsuzawa K, Black RA, Wada I & Sehara-Fujisawa A (200 7) Meltrin beta (ADAM1 9) mediates ectodomain shedding of Neuregu- lin beta1 in the Golgi apparatus: fluorescence correla- tion ... NRG-Glyc _for NRG-TM_rev CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC 339 Kringle (type II) NRG-Kringle _for NRG-Kringle_rev AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA 239 Cysteine ric...
Ngày tải lên: 16/03/2014, 04:20