Báo cáo khoa học: Alanine screening of the intracellular loops of the human bradykinin B2 receptor – effects on receptor maintenance, G protein activation and internalization pdf
... 349 1–3 503 ª 2009 The Authors Journal compilation ª 2009 FEBS 3503 Alanine screening of the intracellular loops of the human bradykinin B 2 receptor – effects on receptor maintenance, G protein activation ... depend on the cell type and the receptor expression levels. Although the processes of signaling and regulation of human B...
Ngày tải lên: 29/03/2014, 23:20
... proportion of errors, patient outcomes arising from the error and types of error. The proportion of MEs reduced following the introduction of CPOE. There was also some evidence that a learning curve occurred ... details of MEs and the total number of drugs prescribed daily during the data collection periods, during the course of his normal chart review. Results...
Ngày tải lên: 25/10/2012, 10:39
... long-range 1 H– 13 C correlation was detected between the carbonyl carbon of the serine and the d-CH 2 of the hOrn, which constitutes the DKP. Therefore, putting all these long-range connections together, ... on the investigation of erythrochelin- mediated angiotensin-converting enzyme inhibition, aiming to assign a bioactivity going beyond iron chelation. On the bas...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx
... primer, 5¢-GAC CAGCTTCATGTGGCCATCGTGCAGGTT-3¢; reverse primer, 5¢-CACGATGGCCACATGAAGCT-3¢) to PCR- amplify the coding regions of these domains in the panC gene from E. coli genomic DNA [44]. The amplified ... along the protein backbone for Glu5–Glu20 of nPS. Fig. S2. Secondary structure distribution of nPS in solution along with the sequence, short-range NOE pattern, and se...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... Location of the interchain disulfide bonds of the fourth component of human complement (C4): evidence based on the liber- ation of fragments secondary to thiol–disulfide inter- change reactions. ... proteolysis destroys the information on the size of the protein and the connectivities of the pep- tide fragments, but it has no size limit for protein digest...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Oxidized elafin and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf
... 5¢-CGACTCGA GAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGAC TCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ were used for amplification of the elafin and the trappin cDNA 5¢ end, respectively, and reverse primer 5¢CGAGCGGCCG CCCCTCTCACTGGGGAAC-3¢ ... reverse primer 5¢CGAGCGGCCG CCCCTCTCACTGGGGAAC-3¢ was used for the common 3¢ end of elafin and trappin. Oligonucleotides 5¢-GGTGCG CCTTGTTGAATCC-3¢ (for...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Diversity and junction residues as hotspots of binding energy in an antibody neutralizing the dengue virus doc
... 102 103 C S R / G W E G F A Y / W -TGT TCT AGG GGC TGG GAG GGG TTT GCT TAC TGG- Fig. 1. Genetic rearrangements and hypermutations in the CDR3 loops of mAb4E11. The nucleotide and amino-acid residues ... rearranged variable V genes, the variability of the junctional sites and the addition or deletion of nucleotides create new codons at the junctions of the ge...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... extension. The primers were 32 P end-labeled oligonucleotides with the following sequences: 5¢-GC GGGAGTTTCACGCCACCAAGATCC-3¢ (MMTV, 10 pmol) and 5¢-GGCTTGGTGATGCCCTGGATGTTAT CC-3¢ (H4, loading control, ... of glucocorti- coid ligands and in the presence of androgen, progesterone and their respective nuclear receptors (Fig. 1A) [3]. Six translationally positioned nucleosomes (...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx
... 43 3–4 43 ª 2005 FEBS 435 The collision induced negative ion mass spectrum (MS ⁄ MS) of the [(M-H) – -SO 3 ] – ion of eugenin is shown in Fig. 4. There are a number of backbone cleavages in negative ... to euge- nin, indicating that eugenin is indeed acting through CCK 2 receptors. To further investigate the interaction of eugenin with CCK 2 receptors, we investigated...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) ... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- b...
Ngày tải lên: 19/02/2014, 17:20