Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... CGTTCTTAGAAGCGGTGCATTTTCC PAF K3 5A opafK35Ase GTTTGATAACAAGGCTTGCACCAAGG pPic9KmpafopafK35Arev CCTTGGTGCAAGCCTTGTTATCAAAC PAF K3 8A opafK38Ase GAAGTGCACCGCTGATAATAACAAATG pPic9KmpafopafK38Arev CATTTGTTATTATCAGCGGTGCACTTC PAF K35,3 8A opafK35,38Ase ... CATTTGTTATTATCAGCGGTGCACTTC PAF K35,3 8A opafK35,38Ase GTTTGATAACAAGGCTTGCACCGCTG pPic9KpafK3 8A opafK35,38Arev CAGCGGTGCAAGCCTTGTTATCAAAC PAF K9,35,3 8A opafK9Ase GGAAAATGCACCGCTTCTAAGAACG pPic9KpafK35,3 8A opafK9Arev ... FEBS Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum Gyula Batta1, Tere´z Barna1, Zolta´nGa´spa´ri2,...
- 16
- 408
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... P406L,V407F and H438N can affect the conformational dynamics of EF-G through their effect on the structure and dynamics of the linker, but can also affect the FA-binding pocket at the domain interface.Residues ... structure and analysis of a target for fusidic acidYang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria SelmerDepartment of Cell and Molecular Biology, Uppsala University, SwedenIntroduction Protein ... largechanges between the free and ribosome-bound states of EF-G, and thus the same mutations can also affect the conformational dynamics of EF-G.Gly617 and Gly621, situated in helix A V, are in the contact...
- 15
- 474
- 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... process of the larval stage parasitesM. Khyrul Islam1, Takeharu Miyoshi1, Harue Kasuga-Aoki1, Takashi Isobe1, Takeshi Arakawa2,Yasunobu Matsumoto3 and Naotoshi Tsuji11Laboratory of Parasitic ... 2815(5¢-CCGAGCTCGAGACGTGAAGCGACAATCTCGCAATCT-3¢) containing an XhoI (Promega) site upstream of the start codon and an antisense primer (5¢-CAGCCAAGCTTCTCACTCTTTGATGAAATGCATCT-3¢) con-taining a HindIII ... cloning and characterization of a geneencoding the soluble PPase of the roundworm Ascarissuum. The predicted A. suum PPase consists of 360 aminoacids with a molecular mass of 40.6 kDa and a pI of...
- 13
- 691
- 0
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
... CTCTTTGATGACAGAAGTGCCT-3¢Syndecan-4 5¢-85 GAGTCGATTCGAGAGACTGA-3¢ 3655¢-450 AAAAATGTTGCTGCCCTG-3¢Glypican-1 5¢-566 GAATGACTCGGAGCGTACACTG-3¢ 4885¢-1054 CCTTTGAGCACATTTCGGCAA-3¢P450 aromatase 5¢-1555GCTTCTCATCGCAGAGTATCCGG-3¢ ... 5¢-1555GCTTCTCATCGCAGAGTATCCGG-3¢ 2895¢-1821CAAGGGTAAATTCATTGGGCTTGG-3¢b-actin 5¢-2350 ACAGACTACCTCATGAAGAT-3¢ 6655¢-3222 AGCCATGCCAAATGTCTCAT-3¢Fig. 1. Dose-related eect of bFGF on FSH-stimulated ... interassay coef®cients of variation were lessthan 10%. The analysis o f the radioimmunoassay data wasperformed using the SECURIAprogram from the PackardInstrument Company (Meriden, CT, USA).DNA...
- 10
- 624
- 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... hydrolases (mainly a- amylases) and transglycosidases (principally CGTases)was not readily defined, because maltogenic a- amylase,acarviose transferase, and the archaeal CGTase clusteredtogether at a distance ... yellow, acarviose transferase; pink, maltogenic a- amylase; blue, a- amylases from Bacillus and actinomycetes; light blue, a- amylases from fungi and yeast; green, maltotetraohydrolases and maltopentaohydrolase. ... domains D and E, they do not normallycontain an N-domain, and are thus five-domain proteinspossessing the catalytic (b /a) 8-barrel (domain A) and the four domains B, C, D and E. In the case of...
- 11
- 615
- 0
Báo cáo khoa học: Functional symmetry in the isolated domain demonstrated by N-ethylmaleimide labelling pdf
... are 5¢-GAAGAGTGGGCAACGGATCCGATAATATTTAAG and 5¢-CATTTCCTGCTGTCTGCAGTCAGACAAGTTTGAAG, respectively. The restrictionsites encoded within these primers are underlined. The C-terminal NBD was ... 5¢-CAGCACGGAAGGCGAATTCCCGAACACATTG and 5¢-CTTTGTTCCAGCCTGCAGTCAGACCATTGAAAA, respectively (restriction cloningsites underlined). N-terminal and C-terminal NBDs werecloned into the pMal-C2X ... as part of the kinetics of the transport cycle of the intact transporter. Furthermore, the data demon-strate that the two NBDs interact in a similar manner with2-deoxy-ATP and CTP. Lastly, the...
- 10
- 386
- 0
Báo cáo khoa học: EcR expression in the prothoracicotropic hormoneproducing neurosecretory cells of the Bombyx mori brain ppt
... and the opticlobe of day-2 pupae: a crucial stage for the morpholo-gical and neurological reorganization of the brain. 20Einduces differentiation of the optic lobe and adult eyein Manduca ... 5¢-ATAACGGTGGCTTCCCGCTGCG-3¢ and 5¢-CGGTGTTGTGGGAGGCATTGGTA-3¢, and RpL32 5¢-GAGGACGAAGAGATTTATCAGGCA-3¢ and 5¢-CGAAGAGACACCATGAGCGAT-3¢. PCR wascarried out in a 10 lL volume containing 10 mm Tris ⁄ HCl(pH 8.8), ... brains of day-2 and day-7 fifth instar larvae and day-2 pupae. EcR -A and PTTH expression wasdetected exclusively in two pairs of LNCs in day-2 fifthinstar larvae (Fig. 3A, left). The merged image...
- 8
- 300
- 0
Báo cáo khoa học: Methods to monitor the quaternary structure of G protein-coupled receptors doc
... Biotechnology and Biosciences Research Council, the Medical ResearchCouncil and the Wellcome Trust to Graeme Milligan and the Canadian Institute for Health Research and the Heart and Stroke Foundation of ... donor and acceptor (X-axis). The distance isexpressed as the ratio of the distance ‘r’ separating the donor and the acceptor over the distance resulting in 50% of the maximalefficacy (R0). As ... bi -functional reagents, is anextension of the basic cross-linking and immunopre-cipitation strategy but has the added advantage of assisting identification of potential protein protein interaction...
- 12
- 337
- 0
Báo cáo khoa học: "TENSE TREES AS THE "FINE STRUCTURE" OF DISCOURSE" ppt
... what the speaker uttered, they are part of what the hearer gathers from an utterance. Speaker and Hearer are indexical con- stants to be replaced by the speaker(s) and the hearer(s) of the ... episodes and the utterances them- selves) in a way that echoes the hierarchy of temporal and modal operators of the sentences and clauses from which the tokens arose. In this respect, they are anal- ... are anal- 2In general, the context structure would also contain speaker and hearer parameters, temporal and spatial frames, and to- kens for salient referents other than episodes, among other...
- 9
- 338
- 0
Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx
... may indicate similar domain structures and assemblyproperties that are stabilized in the presence of ATP. Aswith aB-crystallin, ATPcS (a nonhydrolyzable A TP analog)did not enhance the chaperone ... immunoblotanalyses of the expression and purification of MTBHSP 16.3. Induction of protein expression with IPTGresulted in the a ppearance of a protein band atapproximately 16.3 k Da (Fig. 1 A, lanes ... upernatant was thenready for purification using the Pharmacia FPLC system. The supernatant containing the soluble protein wasfiltered through a 0 .22 lm filter and was loaded onto a HighTrap Q Anion...
- 8
- 310
- 0
Từ khóa: báo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt pottài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM