Báo cáo khoa học: Regulatory feedback loop between NF-jB and MCP-1-induced protein 1 RNase pdf
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf
... Hungary Fax: +36 62 433503 Tel: +36 62 599687 E-mail: Henrik@brc.hu (Received 21 February 2005, accepted 10 May 2005) doi :10 .11 11/ j .17 42-4658.2005.04757.x Abdominal-B (Abd-B) is a complex homeotic gene ... large (over 10 kb), autonomous cis -regulatory domains, iab-5, iab-6, iab-7 and iab-8 in segments A5, A6, A7 and A8, respectively (reviewed in [3,4]). As illustrated in Fig. 1...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx
... +86 23 654 616 96 Tel: +86 23 654 616 96 E-mail: yshuang.tmmu@gmail.com (Received 3 December 2009, revised 3 February 2 010 , accepted 11 February 2 010 ) doi :10 .11 11/ j .17 42-4658.2 010 .07 615 .x Tumour ... ultrastruc- ture, and chronotropic response to isoproterenol. Circ Res 50, 10 1 11 6. TRAP1 protects cells from hypoxic injury by MPTP F. Xiang et al. 19 38 FEBS Journal 277 (2...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf
... 23 285384 CeHSF1 DmHSF 53 59 58 31 30 hHSFY1 31 ScHSF CeHSF1 53 31 46 32 hHSFX1 20 hHSF5 37 49 21 19 12 3 13 0 203 396 427 52 51 16 12 0 13 0 203 380 405 411 442 53 51 8 11 2 11 9 19 2 359 384 390 4 21 49 21 10 11 4 12 1 19 4 355 380 49 21 18 12 2 12 9 202 395 426 4 911 21 125 13 5 208 ... 3 71 376 408 564 1 22 12 6 13 3 206 390 415 4 21 453 46 71 17 12 1...
Ngày tải lên: 18/02/2014, 04:20
Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx
... of HIP -1 with known functions and results with knockout mice Fig. 1. Various domains of HIP -1. The ANTH ⁄ ENTH domain (38 16 0), coiled-coil domain (3 71 610 ), and talin-like domain ( 814 11 12) were predicted ... revised 15 May 2008, accepted 18 June 2008) doi :10 .11 11/ j .17 42-4658.2008.06563.x Huntingtin protein (Htt), whose mutation causes Huntington’s disease (HD), inter...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Regulation of maize lysine metabolism and endosperm protein synthesis by opaque and floury mutations potx
... 15 690.45(a) a19z19 11 402.26(b) 0 0 0 54852 .13 (a) a19z17 19 406.44(a) 202 61. 95(a) 10 550.99(b) 19 055.38(ab) 18 178.69(ab) a19z15 12 065.24(a) 4832.44(a) 0 0 0 a19z 114 0 0 0 0 22304.39(a) a19z10 45064.00(a) ... 73 01. 23(a) 0 a22z12 18 884.57(a) 19 780.78(a) 13 033 .15 (a) 25436 .17 (a) 0 a22z 115 0 0 0 0 314 31. 73(a) a22z 11 23365.92(a) 18 853.00(a) 0 23972.68(a) 19 5 71....
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: "Towards a model of formal and informal address in English" pdf
... EACL MT workshop, pages 11 5 11 9, Athens, Greece. Jerry Hobbs and Megumi Kameyama. 19 90. Trans- lation by abduction. In Proceedings of COLING, pages 15 5 16 1, Helsinki, Finland. Rebecca Hwa, Philipp ... 2 011 , pages 467–472, Portland, OR. Jenny Rose Finkel and Christopher D. Manning. 2009. Nested named entity recognition. In Proceedings of EMNLP, pages 14 1 15 0, Singapore. Joseph...
Ngày tải lên: 24/03/2014, 03:20
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
... 3 · 10 )7 )50.8 ± 2.6 )3.4 )13 .8 33.6 NarJT–NarG (1 15 ) 0.3 ± 0 .1 3.5 ± 2 · 10 )9 )43 ± 1. 2 4.4 5.2 52.6 0.6 ± 0.2 2.5 ± 1. 9 · 10 )7 )53.7 ± 1. 1 )6.3 )16 31. 4 NarJT–NarG (1 15 ) (At pH 8.0) 1. 3 ... 8.0) 1. 3 ± 0.2 1 ± 1 · 10 )7 )45.5 ± 0.4 1. 9 )5.6 41. 8 NarJ–NarG (1 15 ) (in 500 m M NaCl) 0.2 ± 0 .1 10 ± 1 · 10 )9 )40.3 ± 2.3 7 .1 5.3 52.7 1 ± 0.2 4.3 ± 2...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Specific interaction between the classical swine fever virus NS5B protein and the viral genome pdf
... mutant minus-strand 3¢ UTR (lanes 1 5; –RNA1 to –RNA5). Numbers to the left refe r to t he position o f RNA co ntainin g 600 nucleotides. 11 615 1 413 1 211 1023 45 6 789 11 615 1 413 1 211 1023456789 B A CGGCCC ... cis-acting s equence a t the plus-strand 3¢ UTR for RNA synthesis, RdRp assays containing the 12 3456 – +RNA0 +RNAr1 +RNAr2 +5 UTR ' – 78 12 345678 9 10 111 213 14 A –...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... Arg105 to Ala F 118 A F 118 A F ccagctctctgctggcttatatcggcatggc Phe 118 to Ala G121A G121A F ctgctgttttatatcgccatggcattcgcctac Gly1 21 to Ala Y154S Y154S F ccgacatcgccagcagcttaagcttcgttatggc Tyr154 ... gatgttgctgacggcaccggatgtcttctcg Pro209 to Ala D 211 N D 211 N F gacgccgccgaacgtcttctcgcaaacgc Asp 211 to Asn D 211 A D 211 A F ctgacgccgccggctgtcttctcgc Asp 211 to Ala L225A L225A F cccgatgtac...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Bridging the Gap Between Underspecification Formalisms: Minimal Recursion Semantics as Dominance Constraints" docx
... ϕ M are the handles of M and its literal set is: {h:P x 1 , ,x n (h 1 , . . .) | h:P(x 1 , . . . ,x n , h 1 , . . .) ∈ M} ∪{h:Q x (h 1 , h 2 ) | h:Q x (h 1 , h 2 ) ∈ M} ∪{h 1 ∗ h 2 | h 1 ≤ h 2 ∈ ... predications (EPs) and the third handle constraints: 1. h:P(x 1 , . . . ,x n , h 1 , . . . ,h m ) where n, m ≥ 0 2. h:Q x (h 1 , h 2 ) 3. h 1 ≤ h 2 Label positions a...
Ngày tải lên: 20/02/2014, 16:20