Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt

... (5¢-gaaaggcatcccgaacgcat-3 ); Chip2up primer (5¢-aaatgtcttgaccagccgtc-3 ) and Chip2dw primer (5¢-gaaacaaaggcctctcccag-3 ); Chip3up primer (5¢-gctttgcagt- cagaatggtc-3 ) and Chip3dw primer (5¢-ctgagcactgactac- gaaac-3 ). ... expression analysis. This approach identified the Promyelocytic Leukemia Zinc Finger (PLZF) gene as a putative gene target of CUX1. PLZF...

Ngày tải lên: 29/03/2014, 21:20

... Committee of the University Hospital of Patras. Analysis of genomic DNA for GH and GHR mutations Genomic DNA was isolated from peripheral blood leuko- cytes for the analysis of the GH-1 gene and was amplified using ... Diaz 2 , Dimitris Kletsas 3 , Efthimia K. Basdra 4 , Theodore K. Alexandrides 5 , Zvi Zadik 6 , Stuart J. Frank 7 , Vassiliki Papathanassopoulou 1 , Nicholas G....

Ngày tải lên: 23/03/2014, 10:21

... insects. Annu Rev Entomol 51, 1–24. 7 Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY & Ishizaki H (198 6) Amino acid sequence of a protho- racicotropic ... H, Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Fujino M & Kitada C (198 7) A monoclonal antibody against a synthetic frag- ment of bombyxin (4K-pr...

Ngày tải lên: 18/02/2014, 13:20

... GGAGCAAGAGGTTCAGCATC MLL2 GTGCAGCAGAAGATGGTGAA GCACAATGCTGTCAGGAGAA MLL3 AAGCAAACGGACTCAGAGGA ACAAGCCATAGGAGGTGGTG MLL4 GTCTATGCGCAGTGGAGACA AGTCTGCATCCCCGTATTTG HOXC13-ERE1 GCGTCTCCCTGTCCCTTTA CAGGTCTCCTGGGGTTCC HOXC13-ERE2 ... TTGCCGAGTATATTCCATTGC TCTGCTTTACCTCGCTGGAT HOXC13-ERE3 TTTCAGGCCCTTTGTTTCTC CGCGGGTAGTAGAAGTGGAA HOXC13-ERE4 TGCCCTCATATAAACCTGGAA AGCCTTTGGGAGTAGGAACC ERa antisense...

Ngày tải lên: 18/02/2014, 14:20

... of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B. Chain A Chain B Hydrogen bonds Ala25 Asn77, Arg80 AlaO–ArgNH1 AlaO–ArgND2 Asn26 His35, Arg80, Asn39 AsnOD1–ArgNH1 AsnOD1–HisNE2 Ser28 ... be in contact when at least one atom of a residue of chain A is at a dis- tance shorter than 4.0 A ˚ from an atom of a residue...

Ngày tải lên: 16/02/2014, 14:20

... tuber- culosis DAPA AT by KAPA. (A) The activity was measured at var- ious AdoMet and KAPA concentrations. n 20 l M KAPA; h 50 lM KAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA. (B) Re- plot of the ... 5¢- CGCGCGAATTCAGGAGGAATTTAAAATGCACCAC CACCACCACCACGCTGCGGCGACTGGCG-3¢ contain- ing an EcoRI restriction site, a ribosome-binding site and a His 6 tag coding sequence, and 5¢-GCAAGC...

Ngày tải lên: 07/03/2014, 11:20

... has a glutamine- asparagine pair at the positions defining ATP as a sub- strate instead of the lysine-aspartate consensus. We show that the purified catalytic domain of Rv0386 is active as an AC ... [14]. Here, the substrate-specifying lysine-aspar- tate pair is replaced by asparagine-aspartate and the catalytic asparagine is altered to histidine. Structure determination...

Ngày tải lên: 07/03/2014, 21:20

... the phosphorylation by phorbol 12-myristate 13-acetate acti- vated protein kinase C. J Biol Chem 279, 11444–11455. 12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi M & Nakagawara A (200 3) ... commercial PKC-Pan (Promega, Madison, WI). PKC-Pan was purified from rat brain and consists predominantly of the PKC isoforms a, b and c. Functional association of Ki-1 ⁄ 57...

Ngày tải lên: 16/03/2014, 13:20

... 5¢-GGCATATGATGGAGATGATACTGA-3¢ (rev- erse). SP-1: 5¢-TAGGAGAGATTGGGAGAAATCATC-3¢ (forward) and 5¢-AAGATACCAGAAGGTCGAGAGA GA-3¢ (reverse). GAPDH was included as internal control to correct for equal RNA ... in Table S2. The coefficient of var- iation of pRL activity of each sample was within 2.0–9.0% by statistical analysis of triplicate data (n = 3). Nonradioactive EMSA A DNA pr...

Ngày tải lên: 29/03/2014, 08:20

... CBP is a structural platform that is capable of binding several different families of transcriptional activators [30], and evidence indicates that the KIX domain has the ability to simultaneously ... HRX, Htrx) are associated with a unique subset of acute lymphoblastic or myelogenous leukemias [1–4]. The product of the MLL1 gene is a large protein that func- ti...

Ngày tải lên: 16/02/2014, 14:20