Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot
... compilation ª 2 010 FEBS 3 619 Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 Carlos J. Alme ´ ciga-Dı ´ az 1 , Adriana M. Montan ˜ o 2 , ... selection of promoter, and cotransduction of SUMF1. Abbreviations AAT, a 1 -antitrypsin promoter; AAV, adeno-associated virus; CMV, cytome...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: Inter-flavin electron transfer in cytochrome P450 reductase – effects of solvent and pH identify hidden complexity in mechanism potx
... stacks against the isoalloxa- zine ring of the FAD cofactor thereby preventing hydride transfer from NADPH to the flavin-N5 and thus necessitating a potentially rate-limiting conforma- tional change ... bound cofactors FAD and FMN to catalyse electron transfer (ET) reactions [ 1 5 ]. Evolutionarily, human CPR (78 kDa) originated from a fusion of two ancestral genes encoding for...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: Adipophilin increases triglyceride storage in human macrophages by stimulation of biosynthesis and inhibition of b-oxidation doc
... siRNA–GAPDH-transfected cells incubated in RPMI -16 40 containing 10 0 lgÆmL )1 . (H) siRNA–adipophilin- transfected cells incubated in RPMI -16 40 containing 10 0 lgÆmL )1 VLDL. (I) Average number of ... THP -1 macrophages. THP -1 macrophages were infected with Ad.CMV.GFP or Ad.CMV.adipophilin at 10 0 and 500 m.o.i. Three days later, total proteins and total RNA were isola...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Interflavin electron transfer in human cytochrome P450 reductase is enhanced by coenzyme binding docx
... haem oxygenase [9], the fatty acid hydroxylation system [10 ] and a number of artificial redox acceptors [11 ,12 ] and drugs [1 3 1 7]. CPR is related to a number of mammalian diflavin reductases including ... & Wolf, C.R. (2000) Cloning and characterization of a novel human dual flavin reductase. J. Biol. Chem. 275, 14 7 1 1 478. 21. Narhi, L.O. & Fulco, A. J. (19...
Ngày tải lên: 23/03/2014, 17:22
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf
... severity of synovial in ammation was graded on the basis of colour, angiogenesis and fibrillation: grade 0, no in ammation; grade 1, slight in ammation; grade 2, strong in ammation. The cartilage damage ... proteasome inhibition enhanced TRAIL-induced apoptosis in canine chondrocytes, we examined caspase-8 activation and death receptor-5 (DR-5) and TRAIL protein A B Fig. 1....
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf
... (2004) Reciprocal cross-talk between P2Y 1 and P2Y 12 recep- tors at the level of calcium signaling in human platelets. Blood 10 4, 17 4 5 1 752. 26 Cavallini L, Coassin M, Borean A & Alexandre A (19 96) ... receptors 1 and 4 do not stimulate Gi signaling pathways in the absence of secreted ADP and cause human platelet aggregation independently of Gi signal- in...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Tryptophan tryptophylquinone cofactor biogenesis in the aromatic amine dehydrogenase of Alcaligenes faecalis Cofactor assembly and catalytic properties of recombinant enzyme expressed in Paracoccus denitrificans pptx
... aromatic amine dehydrogenase (AADH) has been achieved in Paracoccus denitrificans. The aauBEDA genes and orf-2 from the aromatic amine utilization (aau) gene cluster of Alcaligenes faecalis were placed under ... orf-4 and hemE) all putatively transcribed in the same direction [7]. The second and fifth genes (aauA and aauB) encode the large and small subunits of AADH, respect...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... (triple) or single mutants HFE-N 11 0A HA, HFE-N13 0A HA and HFE-N23 4A HA or (C) double mutants HFE-NN 110 /13 0AA–HA, HFE-NN234 /11 0A HA or HFE-NN234 /11 0AA–HA, as indicated. Sixteen hours post transfection ... express HFE-WT–HA, HFE-N 110 –HA, HFE-N13 0A HA, HFE-N23 4A HA, HFE- NN 110 /13 0AA–HA, HFE-NN130/234AA–HA or HFE-NN234 /11 0AA– HA proteins. HFE-WT–HA expressing cells were in...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... (5¢-to3¢) Vps4–DEL F TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT Vps4–DEL R ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA Vps4–TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA Vps4–TRP R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4–RDF ... TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4–RDF F GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG Vps4–RDF R CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table 2. Yeast strains used in this study...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: The Mycobacterium tuberculosis ORF Rv0654 encodes a carotenoid oxygenase mediating central and excentric cleavage of conventional and aromatic carotenoids doc
... The column was developed at a flow rate of 450 lLÆmin )1 with 90% A and 10 % B for 5 min, to 5% A and 95% B within 10 min, then increasing the flow rate to 900 lL within 2 min and maintaining these final ... flow rate of 1 mLÆmin )1 with a linear gradient from 10 0% B to 43% B within 45 min, to 0% B within 1 min, then increasing the flow rate to 2 mLÆmin )1 within 1...
Ngày tải lên: 15/03/2014, 23:20