Understanding the Insider Threat: Proceedings of a March 2004 Workshop docx

Understanding the Insider Threat: Proceedings of a March 2004 Workshop docx

Understanding the Insider Threat: Proceedings of a March 2004 Workshop docx

... MITRE dataset of normal, and insider threat” network activities; data from the ARDA NIMD 4 study; data obtained from use of the Glass Box 5 software; synthetically generated data from a simulator; ... result of a post-facto analysis of source, cause, damage, etc. xvi Understanding the Insider Threat: Proceedings of a March 2004 Workshop Figure S.6 Data...

Ngày tải lên: 29/03/2014, 16:20

137 241 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx

... MITRE dataset of normal, and insider threat” network activities; data from the ARDA NIMD 4 study; data obtained from use of the Glass Box 5 software; synthetically generated data from a simulator; ... result of a post-facto analysis of source, cause, damage, etc. xvi Understanding the Insider Threat: Proceedings of a March 2004 Workshop Figure S.6 Data...

Ngày tải lên: 06/03/2014, 16:20

137 344 0
The Design and Implementation of a Sequence Database System * docx

The Design and Implementation of a Sequence Database System * docx

... Management of Data, May 1994. [CS92] Rakesh Chandm and Arie Segev. Managing Temporal Financial Data in an Extensible Database. In Proceedings of the International Conference on Very Large ... Catalog Management: Each E-ADT can provide catalogs that maintain statistics and store schema information. Further, certain values may be named. Query Language: An E-ADT can provide a...

Ngày tải lên: 16/03/2014, 16:20

12 569 0
Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot

Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot

... <www.childinfo.org>. Un balance sobre la mortalidad materna 16 Progreso para la Infancia Las disparidades basadas en la capacidad económica de las familias son a n más marcadas. En 16 países que disponen de datos, ... supervisar para garantizar que la atención que prestan sea de alta calidad, un aspecto que reviste la mayor importancia. Las tasas de asistencia califi cada durante e...

Ngày tải lên: 28/03/2014, 23:20

48 417 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... view the log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data ... area is reserved for this purpose. The separate data area of these database systems means that they do not need the segment cleaning mechanisms of the Sprite LFS to re...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

... with charcoal particles as absorber medium. Desalination. 2003, 153(1-3), 55–64. [3] Al-Abbasi M .A. , Al-Karaghouli A. A., Minasian A. N. Photochemically assisted solar desalination of saline water. ... temperature The year round global solar radiation and ambient temperature data for Chennai is taken from [34]. Figure 8 shows the variation of global solar radiation and the amb...

Ngày tải lên: 05/09/2013, 16:11

26 568 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

... central (what language does and how language does it) rather than placing the elements of language and their combination (known as structural approaches) as central. With in SFL, language is analyzed ... Tsuchida 17. midnight 23. police 25. Japanese embassy 1. Kumiko Tsuchida 1. Kumiko Tsuchida anaphoric anaphoric anaphoric anaphoric exophoric anaphoric anaphoric anaphoric anaphoric anaph...

Ngày tải lên: 07/09/2013, 13:48

39 827 2
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx

... expectations and the performance of the organization’s offerings (see e.g. Parasuraman et al., 1985 & 1988 & 1991). Another stream of research is the performance-based approach (or linear ... producing organization). Project-based organizations generally have a rather limited number of customers, which makes the use of standardized survey -based CSM and statistic...

Ngày tải lên: 15/01/2014, 15:59

37 1,1K 0
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... 18. astronauts 20. astronauts 21. they 13. man 23. the man 26. the man 26. the man anaphoric exophoric cataphoric anaphoric anaphoric anaphoric cataphoric anaphoric anaph...

Ngày tải lên: 12/02/2014, 20:20

18 714 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... CTGAGGTTACAGACAACTGTTC 13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a-...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Từ khóa:
w