... kinetics with a K m of 0.7 lm. This also indicates slow dissociation of the tetramer form, and may explain why linear progress curves are always obtained with all forms of the enzyme and under all incubation ... hyperbolic kinetics with low K m is associated with the tetrameric form and that the low-efficiency negative co-operativi- ty kinetics with high apparent...
Ngày tải lên: 18/02/2014, 12:20
... nrdF + gene was sequenced by a primer walking approach. For DNA analysis, dnastar software (DNAS- TAR Inc., Madison, WI, USA) and clone manager 5.0 (Scientific & Educational Software, Cary, NC, USA) ... all measurements. For GF-AAS measurements, an AAS5 EA system (Carl Zeiss GmbH, Jena, Germany) was used. Manganese was determined at a wavelength of 279.8 nm and iron at 248.3 nm;...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc
... Catlin BW (1990) Branhamella catarrhalis: an organism gaining respect as a pathogen. Clin Microbiol Rev 3, 293–320. 2 Karalus R & Campagnari A (2000) Moraxella catarrh- alis: a review of an ... This study atr1 TGC TTG ATG AGC CTA CCA (atr sense) This study atr2 TGC TGA TGA TGG CAA CTC (atr antisense) This study asd1 AAG CCG ATG ACA CCA ATT (asd sense) This study asd2 GCA GGT TCA T...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: "Automatic Collection of Related Terms from the Web" pptx
... transla- tion. The target application of the method is auto- matic or semi-automatic compilation of a glossary or technical-term dictionary for a certain domain. Re- cursive application of the ... method enables to collect a list of terms that are used in a certain domain: the list becomes a glossary of the domain. A technical-term dictionary can be compile...
Ngày tải lên: 20/02/2014, 16:20
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx
... see Materials and methods) and equal amounts were separated on an 8% SDS/polyacrylamide gel. After blotting onto Hybond-P membrane (Amersham) PCNA was visualized with an anti-PCNA Ig (Santa Cruz Biotechnologies) ... NaCl/P i . During the last wash total DNA was stained with bisbenzimide (2 lgÆmL )1 in NaCl/ P i ). Finally PCNA (Alexa FluorÒ 568 stain) and total DNA (bisbenzimide stain)...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Dual modulation of prothrombin activation by the cyclopentapeptide plactin pptx
... activity 0 1 2 3 05040302010 Xa activity a X aX LP /aX LP /aX aC /aX +2 aC /aX + 2 a V / aX a V / a X aC / LP /aX + 2 aC / LP / aX +2 aC / LP /aX +2 aV / aC / L P /aX + 2 aV / aV / LP /a X aV / LP / aX aC /aX +2 aV ... conversion of scu-PA to the two-chain form. The apparent molecular masses of the resulting poly- peptide chains were comparable with those of...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx
... disappear, and concomitantly one can observe the appearance of two peaks at 1618 and 1683 cm )1 , which are typical of the formation of an intermolecular antiparallel b-sheet aggregate [21]. The thermal ... 600 and 700 MPa also showed a second band with lower mobility. This protein with higher molecular mass could be an aggregated form of the enzyme. Aggregation may ther...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: D88A mutant of cytochrome P450nor provides kinetic evidence for direct complex formation with electron donor NADH ppt
... Spectral changes during reduction with NADPH of the Fe 3+ – NO complex of the wild-type (A) and D8 8A mutant (B) of P450nor. Each spectrum was recorded with a rapid scan apparatus at t he indi- cated ... from the bound haem, blocking of the release of NAD(P) + is more probable than that of Eqn 4 (which must involve the haem) as the cau se of the inactiva...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: "Joint Inference of Named Entity Recognition and Normalization for Tweets" doc
... “···Lady Gaaaaga with her family on Christmas···” and “···Buying a maga- zine just because Lady Gaga’s on the cover···”. It is expected that “Gaga”, “Lady Gaaaaga” and “Lady Gaga” are all labeled ... for example. Suppose “Gaga 1 1 ” and “Lady Gaga 1 3 ” are labeled as PERSON, and there is only one related NE normalization label, which is associated with “‘Gaga 1 1 ” and “Gag...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases pdf
... AAGACATGGACCACA AAGGGAGAAGAGCAGGAG E117K-rev: TGTGGTCCATGTCTTCGTCGAAGCATC RKI GSTU2 P89R -for: TGGCTTCCCTCTGATC GCTACCAGAGAGCTCAA P89R-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC RKV GSTU1 R89P -for: TTGCTTCCCTCTGATC CCTACCAGAGAGCTCAA R89P-rev: ... TTGCTTCCCTCTGATC CCTACCAGAGAGCTCAA R89P-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC PEI PEI E117K -for: TTTGGAAAGTCCAGC ATTGAGGCTGAGTGCCCC E117K-rev: GCTGGACTTTCCAAATGT...
Ngày tải lên: 15/03/2014, 09:20