Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx
Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx
... catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis Rong Cao, Ahmad A. Zeidan, Peter Ra ˚ dstro ¨ m and Ed W. J. van ... and yeast ADHs, indicating that dehydrogenases can be modulated by these nucleo- tides in a nonlinear manner in many organisms. The action of...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt
... anti-mammalian toxins for binding to rat brain synaptosomes [23]. As AahIT4 shares little sequence similarity with any of the known anti-mammalian scorpion toxins [1,12], and no information was available ... quinquestriatus hebraeus was collected from scorpion stings to a parafilm membrane. Sarcophaga falculata (blowfly) larvae and Periplaneta americana (cock- roaches) were bred in...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: "INTEGRATING SEMANTICS KNO FLEXIBLE SYNTAX BY EXPLOITING ISONORPHISM BETWEEN GRAIElATICAL AND SEMANTICAL RELATIONS" pot
... the integration between syntax and semantics. SHEILA correctly analyzes a set of thirty news, generating for each of them a set of records for a relational data base. 2. THE PROBLEM AND OUR ... list of plausible gram- matical relations that can correspond to the seman- tic relation. In a mapping rule each grammatical relation can be constrained by an activa...
Ngày tải lên: 18/03/2014, 02:20
Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx
... this remethylation – methionine and tetrahydrofolate – participate in the active methionine and folate pathways. Impaired methionine synthase activity has been implicated in the pathogenesis of anaemias, ... Protein Assay kit based on the method of Bradford [44]. Standards and sam- ples were assayed in triplicate, according to the manufac- turer’s instructions. Sample...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx
... (Grants BIO2000-0009-P4-C04 and BMC2003-00074), the Escuela Valenciana de Estudios para la Salud (Generalidad Valenciana, Spain, Grant 95 ⁄ 2005) and the Fundacio ´ n Salvat Inquifarma (Spain). References 1 Cartwright ... of C-LytA at 20 °C and pH 7.0, showing two maxima at 265 nm and 290 nm. Upon addition of 20 mm choline (a saturating concentration of ligand), two minima at...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... aggregation and amyloid fibril forma- tion of a pathological mutant (in inherited diseases), or of a normal protein or its normal variant (in sporadic cases). Amyloid fibril formation is regarded as a generic property, ... 2 of ste- fin B and the P79S mutant of the variant at both pH 7 and pH 5. Each panel is a plot of heat change on ligand addition (kcalÆmole )1 ) agai...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx
... ¢-GCAACACCATGGCTTCTTACAAAG TGAAA-3¢ and Fdlw 5¢-CCACAAGCTTGATATCATA TCATAGCATAGCAGT-3¢ and the full length p ea Fd precursor cDNA as template. To facilitate the cloning process, NcoIandHindIII ... Fd-NADP + reductase was purified according to published procedures [32]. Fld from Anabaena was k indly provided by M. Medina (University of Zaragoza, Zaragoza, Spain). ApoFld from Anabaena Fl...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx
... Oxidation of high density lipopro- teins. I. Formation of methionine sulfoxide in apolipoproteins AI and AII is an early event that accompanies lipid peroxidation and can be enhanced by alpha-tocopherol. ... N-Ac-Trp-OMe) and peroxide levels assayed at the indicated times using a modified FOX assay. (¤) Catalase added; (h) no catalase added. Initial peroxide concentrations were...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf
... TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTT Antisense CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAA PrP C RNAi2 Sense TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT Antisense CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCAC Akt ... CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCAC Akt RNAi Sense TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTT Antisense CTAGAAAAAGTAGTCATTGTCCTC...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis docx
... lm [ 32 P ]ATP[ aP] and gave a K d ¼ 86 ± 17 lm (Fig. 7D). ATPase activity is enhanced in the presence of IRE Binding to RNA and ATPase activity are characteris- tics of RNA helicases, and RNA binding increases ... activity, ATP must be hydrolyzed. Indeed, recombinant iron regulatory protein-1 binds ATP with a K d of 86±17lm in a filter-binding assay, and can be pho...
Ngày tải lên: 07/03/2014, 09:20