0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx

Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx

Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP implication for a new regulation mechanism in Lactococcus lactis potx

... catabolic dehydrogenases by elevated moieties of ATP and ADP implication for a new regulation mechanism in Lactococcus lactis Rong Cao, Ahmad A. Zeidan, Peter Ra˚dstro¨m and Ed W. J. van ... and yeastADHs, indicating that dehydrogenases can be modulated by these nucleo-tides in a nonlinear manner in many organisms. The action of an elevated pool of ATP and ADP may effectively inactivate ... similar conclusioncan be drawn for the combination of ADP + NAD for ADH, whereas there was a slight increase in inhibi-tion of ADH by the combination of ATP + NAD.The combinations ATP + NADH and...
  • 10
  • 503
  • 0
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt

... anti-mammalian toxins for binding to rat brainsynaptosomes [23]. As AahIT4 shares little sequencesimilarity with any of the known anti-mammalian scorpiontoxins [1,12], and no information was available ... quinquestriatus hebraeus was collectedfrom scorpion stings to a parafilm membrane. Sarcophagafalculata (blowfly) larvae and Periplaneta americana (cock-roaches) were bred in the laboratory. Albino ... and anti-mammalian b-toxins for binding to cockroach and ratbrain synaptosomes, respectively. Surprisingly, Lqhb1alsocompetes with an anti-mammalian a- toxin on binding to ratbrain NaChs. Analysis of Lqhb1 effects...
  • 8
  • 391
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "INTEGRATING SEMANTICS KNO FLEXIBLE SYNTAX BY EXPLOITING ISONORPHISM BETWEEN GRAIElATICAL AND SEMANTICAL RELATIONS" pot

... the integration between syntax and semantics. SHEILA correctly analyzes a set of thirty news, generating for each of them a set of records for a relational data base. 2. THE PROBLEM AND OUR ... list of plausible gram- matical relations that can correspond to the seman- tic relation. In a mapping rule each grammatical relation can be constrained by an activation condition that relates ... NPs are dealt in a satisfactory way both from a syntactical and from a semantical point of view. Other complex linguistic phenomena (as anaphora, quantification and ellipsis) requires a more...
  • 6
  • 336
  • 0
Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx

Tài liệu Báo cáo khoa học: Inhibition of cobalamin-dependent methionine synthase by substituted benzo-fused heterocycles pptx

... thisremethylation methionine and tetrahydrofolate participate in the activemethionine and folate pathways. Impaired methionine synthase activity hasbeen implicated in the pathogenesis of anaemias, ... Protein Assay kitbased on the method of Bradford [44]. Standards and sam-ples were assayed in triplicate, according to the manufac-turer’s instructions. Sample absorbances were read against a ... counter (Packard Tricarb 1900CA;Perkin Elmer)31.Determination of Km and Vmax for 5-methyltetra-hydrofolateAssays were incubated for 10 min at a fixed concentration of Hcy (500 lm) and varying...
  • 13
  • 424
  • 0
Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

... (GrantsBIO2000-0009-P4-C04 and BMC2003-00074), theEscuela Valenciana de Estudios para la Salud(Generalidad Valenciana, Spain, Grant 95 ⁄ 2005) and the Fundacio´n Salvat Inquifarma (Spain).References1 Cartwright ... of C-LytA at 20 °C and pH 7.0, showing two maxima at265 nm and 290 nm. Upon addition of 20 mm choline (a saturating concentration of ligand), two minima at284 nm and 294 nm appear, whereas the ... that allC-LytA binding sites present the same high-affinitybehavior for choline analogs and become saturated at2mm (Fig. 2A) , and agrees with the higher apparentaffinity of ipratropium and atropine...
  • 13
  • 465
  • 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... aggregation and amyloid fibril forma-tion of a pathological mutant (in inherited diseases), or of a normal protein or its normal variant (in sporadiccases). Amyloid fibril formation is regarded as a genericproperty, ... 2 of ste-fin B and the P79S mutant of the variant atboth pH 7 and pH 5. Each panel is a plot of heat change on ligand addition (kcalÆmole)1)against the ligand ⁄ stefin molar ratio for one of ... Wealso are grateful to Sabina Rabzelj and Sasˇ a JenkoKokalj for performing certain SEC experiments and for activity measurements. We are grateful to ProfessorRoger H Pain for suggesting improvements...
  • 14
  • 586
  • 0
Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx

Tài liệu Báo cáo khoa học: Inhibition of pea ferredoxin–NADP(H) reductase by Zn-ferrocyanide docx

... ¢-GCAACACCATGGCTTCTTACAAAGTGAAA-3¢ and Fdlw 5¢-CCACAAGCTTGATATCATATCATAGCATAGCAGT-3¢ and the full length p ea Fdprecursor cDNA as template. To facilitate the cloningprocess, NcoIandHindIII ... Fd-NADP+reductase was purified accordingto published procedures [32].Fld from Anabaena was k indly provided by M. Medina(University of Zaragoza, Zaragoza, Spain). ApoFld fromAnabaena Fld was ... such as that of certainalgae and cyanobacteria, the FMN-co ntaining protein FldFig. 2. Reduction and oxidation of the flavin. Optical spectra of FNRFAD reduction, 5 s after mixing, measured as...
  • 12
  • 585
  • 0
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

... Oxidation of high density lipopro-teins. I. Formation of methionine sulfoxide in apolipoproteins AI and AII is an early event that accompanies lipid peroxidation and can be enhanced by alpha-tocopherol. ... N-Ac-Trp-OMe) and peroxide levelsassayed at the indicated times using a modified FOX assay. (¤)Catalase added; (h) no catalase added. Initial peroxide concentrationswere in the range of 42 0–5 20 lM for ... 120 min for RNase A) , and were continually aerated. After cessation of photolysis, c atalase (Sigma, bovine liver, 5 lgÆmL)1 for BSA, 50 lgÆmL)1 for lysozyme and RNase A, 250 lgÆmL)1 for p...
  • 10
  • 462
  • 0
Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

... TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTTAntisense CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAAPrPCRNAi2 Sense TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTTAntisense CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCACAkt ... CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCACAkt RNAi Sense TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTTAntisense CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTAMDR-1 Sense CTCGAGGAATCAGCATTCAGAntisense AGATCTCTTTGAGCTTGGAAGAGCMDR-1 ... Changcun Guo, Guanhong Luo, Xin Wang, Guohong Han, Dexin Zhang,Jianhong Wang, Kai Li, Yanglin Pan, Liping Yao, Zhanxin Yin, Xuegang Guo, Kaichun Wu, Jie Ding and Daiming FanState Key Laboratory...
  • 10
  • 448
  • 0
Báo cáo khoa học: Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis docx

Báo cáo khoa học: Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis docx

... lm[32P ]ATP[ aP] and gave a Kd¼ 86 ± 17 lm (Fig. 7D).ATPase activity is enhanced in the presence of IREBinding to RNA and ATPase activity are characteris-tics of RNA helicases, and RNA binding increases ... activity, ATP must be hydrolyzed.Indeed, recombinant iron regulatory protein-1 binds ATP with a Kd of 86±17lm in a filter-binding assay, and can be photo-crosslinked toazido -ATP. Upon binding, ATP ... containing 300 lM ATP in the presence of increasing amounts of recombinant IRP-1. Theposition of free inorganic phosphate is indicated by the arrow. In the last lane, 800 lg of BSA is included as...
  • 12
  • 448
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ