Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx
Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx
... similar binding affinities to that of Six 3a (Fig. 6). These findings indicate a high degree of overlap in binding sites for Six 3a, Six3b, and Six7, and that they might compete for the same recognition ... Identification of ATTA core flanking nucleotides critical for Six 3a HD binding. (A) EMSAs with the Six 3a HD and biotin- labelled a1 probe. Unlabelled frag...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... The Authors Journal compilation ª 2010 FEBS 4561 Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance Wayne M. Patrick 1,2, *, ... Phe144 apparently in a position to interact with the b-1,3-glucan substrate. Strikingly, the carbo- hydrate -binding module CBM 4-2 of a bacterial lamin- arinase...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Polysaccharide binding sites in hyaluronate lyase – crystal structures of native phage–encoded hyaluronate lyase and its complexes with ascorbic acid and lactose docx
... that ascorbic acid may bind at the saccharide binding site. Therefore, it may act as a protective factor for the host tissue hyaluronan because these tissues are not degraded by the hyaluronate ... acid against HylP2. For the first time, the present study provides insight into the inhibitor binding sites in HylP2 and postulates the substrate binding regions in...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Starch-binding domains in the CBM45 family – low-affinity domains from glucan, water dikinase and a-amylase involved in plastidial starch metabolism pptx
... 2011) doi:10.1111/j.1742-4658.2011.08043.x Starch -binding domains are noncatalytic carbohydrate -binding modules that mediate binding to granular starch. The starch -binding domains from the carbohydrate -binding module family 45 ... represent the integrated binding heat of the data in the top panel, and the full line is the fit of a one-site binding model to the...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx
... 5¢- TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E19 0A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ ... between the A and B chains of insulin, resulting in the aggregation and precipita- tion of the B chain. Reduction stress assays are advan- t...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot
... to GAL1-10 and GAL2 is reduced by approximately 50% in strains lacking either the Swi1 or the Snf5 activator -binding domains (Fig. 3). In the strain lacking both activator- binding domains, the ... together, these findings suggest that the predominant coactivating role of SWI ⁄ SNF may be at steps downstream of activa- tor binding rather than as a facilitator of activator...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx
... 4807 A Fig. 2. Location of insertion sites in conserved regions. Location of insertions in N-terminal AAA + domain (domain I, shown in A) , central domain (domain II, B) and C-terminal collar domain ... Rfc4 (RFC-B). The side chain of the arginine is referred to as an arginine finger and the finger protrudes into the ATP -binding site of the neighbouring subunit. The exa...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... of the senR gene and the in- frame fusion with the His-tag codons. Purification of the fusion proteins An E. coli XL1-Blue transformant containing the pASKS2 or pASKS2H19 9A plasmid was inoculated ... sites. Fragment Primer name Primer sequence (5¢-to3¢; restriction sites in bold type) A IHinfor CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS) IEcorev CGAGAATTCGAAAAC...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Large conformational changes in the Escherichia coli tryptophan synthase b2 subunit upon pyridoxal 5¢-phosphate binding pot
... 1184–1192. 18 Yamagata Y, Ogasahara K, Hioki Y, Lee SJ, Nakaga- wa A, Nakamura H, Ishida M, Kuramitsu S & Yutani K (2001) Entropic stabilization of the tryptophan synthase a- subunit from a hyperthermophile, ... upon PLP binding. The conformational changes in the peak 4 region near Thr319 are also affected by alterations transmitted from the peak 3 region. The C termin...
Ngày tải lên: 15/03/2014, 11:20
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... the same position as zinc, indicating that the proteins binding zinc in these fractions scarcely contained any aromatic amino acid residues. This suggests that the proteins are metallothioneins, well-known ... to MYP. The elution patterns of zinc were similar in the ovary and testis, but the zinc peak in the immature ovary was larger than that in the immature tes...
Ngày tải lên: 16/03/2014, 05:20