Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot

... Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand Aitziber L. Cortajarena 1 , Jimin Wang 1 and Lynne Regan 1,2 1 Department of Molecular Biophysics ... three TPR repeats (AB-helix pair) and an additional C-terminal capping helix (A cap ). The only way for molecules AB–AB–AB A cap to arrange on ‘head-to-tail’ pack...

Ngày tải lên: 29/03/2014, 08:20

... first structure of a cold-adapted subtilase to be determined and its elucidation facilitates examination of the molecular principles underlying temperature adaptation in enzymes. The cold-adapted ... sta- tistical approaches analysing structural parameters in large samples of dissimilar proteins regarding the origin and temperature range, do not show significant trends regarding...

Ngày tải lên: 19/02/2014, 16:20

... HinCel 6A (Tyr104 and Glu108, Table 2. Amino acid residues interacting with the ligands or poten- tially involved in the catalysis, and the corresponding residues of HjeCel 6A, HinCel 6A and HinCel6B. ... 1.14 A ˚ (CcCel6C–HjeCel 6A, 1QK0 chain A) and 1.30 A ˚ (CcCel6C–HinCel6B, 1DYS chain A) for main chain atoms. The significant feature in cellobiohydrolases HjeCel 6A and Hi...

Ngày tải lên: 15/03/2014, 10:20

... hydrolysis of the critical b-lactam ring and render the antibiotic inactive against its original cellular target, the cell wall transpeptidase. b-Lactamases of Keywords class C b-lactamase; cold adaptation; psychrophile; ... enzymes. Frequently, alterations of the accessible surface of nonpolar side chains and of the accessible charged sur- faces are observed in cold-adapted enz...

Ngày tải lên: 23/03/2014, 07:20

... using a- cyano-4-hydroxycinnamic acid (CCA) as the matrix. Protein crystallization Crystallization trials were carried out using the hanging- drop vapor-diffusion method at 293 K. Crystals were obtained a few days after ... Collen, D. & Lijnen, H.R. (1993) Interaction between staphylokinase, plasmin(ogen), and alpha 2 -antiplasmin. Recycling of staphylokinase after neutralization o f...

Ngày tải lên: 23/03/2014, 21:21

... reaction with the inhibitors. Co-crystallization assays Co-crystallization assays were carried out using a protein solution at 10 mgÆmL )1 preincubated with 2 m M inhibitor. Crystals of the complex ... Cys166 and the nicotinamide ring of the NAD + cofactor during catalysis. The average isotropic temperature factor values for the main chain and all atoms of the 359 residues from...

Ngày tải lên: 20/02/2014, 02:21

... underlined, with the half site also present in the operator in bold). Name Length (bp) Sequence 1IR 39 GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT 1DR 45 ATACCC GGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC 1DR-short ... Spain RepA is the DNA replication initiator protein of the Pseudomonas plasmid pPS10. It is representative of a family of plasmid replication initiators active in many...

Ngày tải lên: 07/03/2014, 04:20

... importin -a structure that incorporates the N-terminal autoinhibitory domain (PDB:1IAL, rmsd of 0.20 A ˚ across 425 C a atoms in residues 72–496). The major binding site spanning ARM repeats 2–4 has ... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data...

Ngày tải lên: 14/02/2014, 19:20

... and hydrolyze metal-free phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site at the interface of the two domains [4,5]. ... maps and the location of errors in these models. Acta Crystallogr A 47, 110–119. 32 Nayal M & Di Cera E (1996) Valence screening of water in protein cry...

Ngày tải lên: 16/02/2014, 09:20

... residues of a putative trans- membrane region. The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal trypsin-like serine proteinase domain, as shown in ... reveals that the most similar regions of these proteinases medi- ate interaction of the two b-barrels, formation of the catalytic machinery and structures required for binding...

Ngày tải lên: 19/02/2014, 00:20