Báo cáo khoa học: Sp3 transcription factor is crucial for transcriptional activation of the human NOX4 gene doc

... essential for transcriptional activation of the human NOX4 promoter Figure 1 shows the alignment of the 5¢-flanking and 5¢-noncoding sequences of the human, rat and mouse NOX4 genes. Compared with the ... similarity between the rat and mouse sequences, the similarity of the human sequence was relatively low. Therefore, we isolated the promoter region o...

Ngày tải lên: 29/03/2014, 00:20

... tissues. Two types of KLK11 isoforms, isoform 1 and isoform 2, have been predicted from cDNA sequences. Iso- form 1 has been isolated from human hippocampus, whereas isoform 2 has been isolated from ... antibody raised against KLK11 was the same size as that of the translational product by isoform 2 mRNA (Fig. 4B). The product by isoform 1 mRNA was smaller than the isoform 2 pro...

Ngày tải lên: 19/02/2014, 06:20

... in the endocrine cells from that in the nonendocrine intestinal epithelia. However, as the non- endocrine cell lines utilized in this study are cancerous cells of human origin, we employed the ... (1996) Cis-Acting elements and tran- scription factors involved in the intestinal specific expression of the rat calbindin-D9K gene: binding of the intestine-specific transcrip...

Ngày tải lên: 30/03/2014, 16:20

... animals [21,22]. These charac- teristics resemble those of the natural aging process in humans and other animals. As the inner ear tissue is unacquirable during life in humans, and the genetic and ... account for the two copies of the b-actin gene in each cell nucleus. The mtDNA copy number of the control group was taken as the reference point to calculate the re...

Ngày tải lên: 14/03/2014, 23:20

... range of genes involved in the synthesis of cholesterol, fatty acids, and phospholipids. All mammalian cells require these lipids for the duplication of membranes in cell division. Depending on the ... have been established as transcription factors regulating the transcription of genes involved in cholesterol and fatty acid synthesis [1,2]. SREBP proteins are initially b...

Ngày tải lên: 23/03/2014, 07:20

... opening a new vista for genotype-directed therapy in this disease. KRAS mutation as a mechanism of resistance to EGFR-targeted therapy The KRAS protein is localized to the inner surface of the cell ... result in the for- mation of lung adenocarcinomas, demonstrating that expression of these constitutively activated forms of EGFR is sufficient for transformation and...

Ngày tải lên: 16/02/2014, 09:20

... mediates activation of Ras subsequent to the stimulation of G i - and G q - coupled receptors [8,9]. The main mechanism for the activation of Ras- GRF1 is the binding of Ca 2+ ⁄ CaM to the N-terminal IQ ... physiological role of the guanine nucleotide exchange activity of the truncated forms is not known as they are missing the Ca 2+ ⁄ CaM-binding IQ doma...

Ngày tải lên: 19/02/2014, 18:20

... M oreover, the amount of cytochrome P450 aromatase, responsible for the irreversible transformation of androgens into estrogens, is decreased by b FGF at the transcriptional l evel. The bFGF inhibitory ... are m ainly regulated at the transcriptional level. This report s hows that the b FGF r egulation of their expression speci®cally depends on the nature of HSPG...

Ngày tải lên: 21/02/2014, 03:20

... primer for construction of truncated AmyQ variants for synthesis of nascent chains amyQ95 GCCGGATCCTTCTCCTAAATCATACAA Amplification primer for construction of truncated AmyQ variants for synthesis of ... around the filter, which can be visualized by staining of the plates with iodine vapor. The radius of the resulting halos is indicative for the amounts of ac...

Ngày tải lên: 16/03/2014, 22:20

... Lansbury PT Jr (1993) The car- boxy terminus of the b amyloid protein is critical for the seeding of amyloid formation: implications for the pathogenesis of Alzheimer’s disease. Biochemistry 32, 4693–4697. 5 ... explanations for the different results include choice of cell lines, whether the cells overexpress the proteins of interest, and the various detergen...

Ngày tải lên: 30/03/2014, 04:20