Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

... the other hand, the importin a family generally binds to both the nuclear import cargo and importin b, indicating that importin a functions as an adaptor between the cargo proteins and importin ... 2011 The Authors Journal compilation ª 2011 FEBS Targeted disruption of one of the importin a family members leads to female functional incomp...

Ngày tải lên: 28/03/2014, 23:20

... T32 AI060519 and a Department of Education training grant in Graduate Assistance in Areas of National Need (GAANN). References 1 Peterson CL & Laniel MA (2004) Histones and histone modifications. ... Epstein JA, Walsh MJ et al. (2008) Transcription factor AP2delta associates with Ash2l and ALR, a trithorax family histone methyltransferase to activate Hoxc8 transcription. Pr...

Ngày tải lên: 15/03/2014, 09:20

... Alternaria alternata 102 was kindly provided by K Takatori (National Institute of Health Sciences, Tokyo, Japan). A. alternata 102 maintained on a PDA slant (potato dextrose agar; Franklin Lakes, ... Laminaripentaose, N-acetylchito- octaose and glycolchitin remained inactive. Laminarin and the AaGlucan triggered a similar level of chitinase activity. However, laminarin was applied...

Ngày tải lên: 23/03/2014, 11:20

... resulted in the total loss of this activity when assayed in the usual way, i.e. after addition of H 2 , a catalytic amount of NADH and the subsequent addition of BV. Restoration of this activity (to ... reduction was, however, the same for all enzyme samples used in this study. As outlined in the present paper, the variable hydrogenase activities can be ascrib...

Ngày tải lên: 07/03/2014, 15:20

... target specificity and may act on many membrane types including those of erythrocytes (haemolytic activity). For example, the synthesis of a variety of analogues of the 13-amino acid, tryptophan-rich ... aliquots were placed in the bottom of a 1.5-cm diameter, 10-mL glass tube, and the solvent was dried at room temperature in a stream of argon gas, to provide a...

Ngày tải lên: 08/03/2014, 08:20

... hormone to the N-terminal domain of the receptor translates into activation of its serpentine domain is unknown. With the aim of improving our understanding of the mechanisms underlying some of these ... relative abilities to stimulate the cAMP or IP regulatory cascades. Surprisingly the combination of a strong inactivating mutation with an activating one produ...

Ngày tải lên: 08/03/2014, 08:20

... explained by the absence of an activator function of Mcm1 in MATa cells. Mcm1 acts as an activator of a- cell-spe- cific genes in MATa cells, whereas it acts as a repressor in MATa cells. Taken together, ... When dThd CDC BrdU CDC + + + + + + + + + A dThd CDC BrdU CDC + + + + + + B 123 456 789 101112 3′-CGTACATTAATGGCATTTTCCTTTAATGTAC-5′ 3′-GTACATTAAAGGAAAATGCCATTAATGTACG-5′...

Ngày tải lên: 15/03/2014, 23:20

... that has produced the rate change. The parameter can act in any reaction of the module and can affect the rate of the reaction in any functional way. This approach is inspired in the one proposed ... varying the ATP ⁄ ADP ratio and measuring the supply and demand rates independently. The decrease in the ATP ⁄ ADP ratio was achieved by overexpressing the h...

Ngày tải lên: 30/03/2014, 10:20

... were also analyzed according to the Scatchard method [47]. Linear regression analyses of binding data gave dissoci- ation constants (K d ), calculated from the reciprocal of the slopes. Association ... binding data were analyzed either by nonlinear regression analysis or by the method of Scat- chard. Nonlinear regression analysis of data from indi- vidual binding curves indi...

Ngày tải lên: 14/02/2014, 14:20

... GCGCGTGAACCGGAGTT ACCCGATGATAGGCTTC Y11 5A CGCTGGAAACCTCTTGG GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D ... AAGCTCTGAAGCTCTTC M436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCA H428D AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG C...

Ngày tải lên: 15/02/2014, 01:20