... grammar development have been taken during last decades. Automatic grammar development means that a system extracts a grammar from a Treebank which has an implicit Treebank grammar. The grammar ... extracting grammars from a Tree- bank A feature structure is a way of representing gram- matical information. Formally feature structure consists of a specification of...
Ngày tải lên: 23/03/2014, 18:20
... rACT 8.20 ,5¢-TACCGCGGTCAAAATCACCCTCC GTTCTCGAGCAGTGGAGACGCGTGA-3¢;rACT 6.3 , 5¢-TACCGCGGTCAAAATCACC AGGAGGTCTATC GATGTGGAGACGCGTGA-3¢;rACT 8.3 ,5¢-TACCGCG GTCAAAATC AGGGGGAGATCTGAGTTAGTGGA GACGCGTGA-3¢;rACT 6.7 ,5¢-TACCGCGGTCAAAAT C AAGCTTAGAACAACATTAGTGGAGACCGCTG A- 3¢;rACT 6.1 ,5¢-TACCGCGGTCAAAATCATGACAA GATCTAACTTAGTGGAGACGCGTGA-3¢;rACT 5.18 , 5¢-TACCGCGGTCAAAATCACC GAGCGTGTCTCG CCCGTGGA...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc
... of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library Andy Chevigne ´ 1 , Aure ´ lie Fischer 1 , Julie Mathu 1 , Manuel Counson 1 , Nadia Beaupain 1 , Jean-Marc Plesse ´ ria 1 , ... Tamamura H, Imai M, Ishihara T, Masuda M, Funakoshi H, Oyake H, Murakami T, Arakaki R, Nakashima H, Otaka A et al. (1998) Pharmacophore identification of a chemokin...
Ngày tải lên: 28/03/2014, 22:20
Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx
... forward primer AB 348, 5¢-TTAGCAAAACCTC ATACAGAA-3¢, and the backward primer AB 349, 5¢-GATGCTGTCTTTCGCTGCTGAG-3¢,wereusedfor DNA amplification. The M13 forward primer, 5¢-ATTCACCTCGAAAGCAAGCTG-3¢,wasusedfor sequencing. Table ... plasmon resonance Phage ELISA appeared to be an efficient qualitative assay. However, it cannot be used to measure accurate K d values because the affinity of the I...
Ngày tải lên: 31/03/2014, 01:20
Tài liệu Báo cáo khoa học: Destabilization of psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses pdf
... extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8, 528–535. 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M ... localized fashion as revealed by mutational and X-ray crystallographic analyses Muhammad S. Rohman 1 , Takashi Tadokoro 1 , Clement Angkawidjaja 1 , Yumi Abe 1 , Hiroyoshi Matsumura 2,3 , Y...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt
... capture of the electron into an amide carbonyl group that is hydrogen bonded to the protonated side chain of a basic amino acid. The resulting radical anion abstracts a proton and gen- erates a radical ... radiofrequency electrostatic fields rather than with static magnetic and electric fields. High-quality ECD spectra often require the averaging of data from large numbers of...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Selection of stably folded proteins by phage-display with proteolysis docx
... MINIREVIEW Selection of stably folded proteins by phage- display with proteolysis Yawen Bai and Hanqiao Feng Laboratory of Biochemistry, National Cancer Institute, Bethesda, MD, USA To facilitate the ... several rounds of protease digestion and amplification of the library, variants with high thermodynamic stability were enriched over those that have low thermodynamic stability. A...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... derivative of tRNA Gly 1 -1 has a single TATA ele- ment at )130 bp and is transcribed to the same levels as the parent. pmutRKX3 has the single TATATAA element of pRKX3 mutated to GATATCA. tRNA Gly 1 -6,7 ... shut off. By contrast, when there is demand for large excesses of a particular type of tRNA, as in the PSG, and sufficient quantities of transcription factors are available,...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo khoa học: "Learning to Compose Effective Strategies from a Library of Dialogue Components" doc
... reward expected be- tween taking that action and the end of the dialogue. For each state-action pair (s, a) , we calculated this expected cumulative reward Q(s, a) of taking action a from state ... reinforcement learning for auto- matic dialogue policy optimization in a question- based motivational dialogue system. Our system can automatically compose a dialogue strategy from...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx
... 4-12-1 Nakanarusawa Hitachi, Ibaraki, 316-8511, JAPAN shinnou@lily, dse. ibaraki, ac. jp Abstract In this paper, we propose a practical method to detect Japanese homophone errors in Japanese ... using various 1 '~' ~.,~. and '~.~ m~,' have a same phone 'i-sift'. The meaning of '~,' is a general will, and the meaning of '~:~&apos...
Ngày tải lên: 22/02/2014, 03:20