Social capital and Health status: a protective impact among elderly or inactive but not among active ? doc

... Health Social participation (Instrumental Equation) p-value p-value 1 Social capital and Health status: a protective impact among elderly or inactive but not among active ? Caroline Berchet, ... concerning social capital indicates that social participation is associated with the probability to report a good health status among bo...

Ngày tải lên: 28/03/2014, 20:20

... position and health in a population of Brazilian elderly: the Bambuí Health and Aging Study (BHAS) Maria Fernanda Lima-Costa, 1 Sandhi M. Barreto, 1 Josélia O. A. Firmo, 1 and Elizabeth Uchoa 1 Objective. ... mental health (insom- nia and psychiatric symptoms); (5) his- tory of selected diseases (asked as, “Has a doctor ever said that you had angina pectoris, myocardial...

Ngày tải lên: 14/03/2014, 20:20

... Gujrat, Gujrat, Pakistan. 519 Family Support and Health Status of Elderly People: A Case Study of District Gujrat, Pakistan Muhammad Shoaib, Sarfraz Khan and Mohsin Hassan Khan 1 1 2 Department of ... relationship between family support and health 5. Litwin, H., 1998. Social Network Type and Health status of elderly people in rural area of Gujrat. Status in a National...

Ngày tải lên: 14/03/2014, 20:20

... 64, and 17% are ages 65 and older. Age is an important determinant of health status and health care utilization. While white women account for the majority of the female population, a large ... minority of women are women of color—Latina, African American, Asian/Pacific Islander, or another racial, mixed race, or ethnic subgroup. There is a large and growing body of re...

Ngày tải lên: 12/02/2014, 23:20

... some support for the notion that capital regulation may have contributed to a decrease in lending in Canada and the UK. In a similar study based on Latin American bank data, Barajas et al. (2005) ... capitalization relative to this internal target which captures both regulatory and market measures of capital adequacy, and then analysing how banks adjust their capital and...

Ngày tải lên: 16/02/2014, 10:20

... Examples include Virgin Group and Heinz. - Endorsed brands, and sub-brands These brands include a parent brand which may be a corporate brand, an umbrella brand, or a family brand as an endorsement ... hereafter, are brand strategy, brand equity and brand awareness and managing the brand portfolio. The traditional definition of a brand used in brand management literatur...

Ngày tải lên: 18/02/2014, 08:20

... (Fukuhara, Bito, Green, Hsiao, & Kurokawa, 1998; Han, Lee, Iwaya, Kataoka, & Kohzuki, 2004). Cronbach’s alphas for Physical function were .93 and .92, and .66 and .84 for General Health ... possible health status). Discriminant validity of the Korean and Japanese versions of SF-36 was established and reported Cronbach’s alphas were .93–.94 and .84–.86 in the Korean an...

Ngày tải lên: 22/03/2014, 14:20

... bp) was PCR amplified from chromosomal DNA of P. furiosus using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCG GGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), ... FEBS Metals and inhibitors The effect of several salts, metals and inhibitors on the initial activity of Pf-TDH was checked using butane- 2,3-diol as substrate in the standard oxidation...

Ngày tải lên: 16/03/2014, 14:20

... Providing information that i s congruent with a patient ’sneedsat that particular time is an important determinant for patient satisfaction and affects health- related quality of life (HRQoL) and anxiety and ... treatment and care, and some qualitative aspects, for instance wis hes for more information. The questionnaire contains the following scales: (a) Information about the di...

Ngày tải lên: 05/03/2014, 15:20