ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc

ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc

ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc

... research landscape in the field of Ambient Assisted Living (AAL) in EU-27 Dr. Katrin Gaßner, Michael Conrad 20 ICT enabled independent living for elderly applications that help elderly to maintain ... fact-finding mission. Extensive desk research comprised the search for information – mainly web research – and the analysis of this informat...

Ngày tải lên: 28/03/2014, 16:20

94 517 0
A discussion proposal on people''''s adaptability to floods in the Mekong river delta

A discussion proposal on people''''s adaptability to floods in the Mekong river delta

... Burma and Laos and most of the border between Laos and Thailand, then the main stream goes into Cambodia and finally it flows across southern Vietnam to the sea (figure 1). The river has 4,200 ... to the sea, the MD accepts yearly all the water flood volume of the basin. About 1.2 to 1.9 million ha of land, mainly in the North parts of the MD such as...

Ngày tải lên: 18/10/2013, 12:15

2 482 0
An e-Health System for the Elderly (Butler Project): A Pilot Study on Acceptance and Satisfaction pot

An e-Health System for the Elderly (Butler Project): A Pilot Study on Acceptance and Satisfaction pot

... allows the practitioner to maintain a database on all of the users’ daily emotional information. It also includes an alarm system, which sends a warning to the professional in charge when the user’s ... platform Professional users are the health agents who are part of the Butler network and have clinical responsibility for the users. Their levels of interventio...

Ngày tải lên: 14/03/2014, 20:20

8 733 0
Incentives of Retirement Transition for Elderly Workers: An Analysis of Actual and Simulated Replacement Rates in Ireland ppt

Incentives of Retirement Transition for Elderly Workers: An Analysis of Actual and Simulated Replacement Rates in Ireland ppt

... rules for the corresponding year. The synthetic based simulation uses the year 2000 data for the baseline analysis and the variables simulated and relevant for this exercise are income taxes, various ... disposable income, instead of the simulated counterfactual one as the denominator. There are for two reasons for this: First, one of the main goals of...

Ngày tải lên: 05/03/2014, 18:20

37 539 0
Progress for Children A report card on adolescents docx

Progress for Children A report card on adolescents docx

... developed countries CEE/CIS East Asia and the Pacific (excluding China) Middle East and North Africa Latin America and the Caribbean Eastern and Southern Africa Sub-Saharan Africa West and Central Africa South Asia 0% ... is a clear call for attention to the quality of primary and secondary schools. Education and work Several regions – sub-Saharan Africa, Latin Amer...

Ngày tải lên: 07/03/2014, 04:20

56 288 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA Vps4–TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA Vps4–TRP R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4–RDF F GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG Vps4–RDF R CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table ... for the RDF sequence in modulating the function of the SRH. The C-terminal region of human VPS4B contains the b domain (b strands 7 a...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx

Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx

... surveyed maximum capacity. Appendix 2 also shows the average capacity for small and large labs. The maximum capacity is given for all labs. A final consideration regarding available capacity ... 2004. The survey aimed at finding out minimum, average and maximum estimates of costs/prices and the available average and maximum testing capacities. The data explorati...

Ngày tải lên: 23/03/2014, 05:22

19 493 1
Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century

Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century

... pastures for sheep-raising and wood-making industries. They had to join the force of cheap labor and working in such factories. England became a typical example of initial accumulation of capitalism. ... relationship in “ Robinson Crusoe” can also be seen as a relation of capitalism as they devided labour among them with equal shares. The fact is that Robinson sav...

Ngày tải lên: 26/11/2012, 12:02

15 2,3K 13
w