Báo cáo khoa học: "CASE ROLE FILLING AS A SIDE EFFECT OF VISUAL SEARCH" pdf
... 5: Case slot filling as side effect of visual search in their parents. Instance variables comprise information about the deep cases associated with the motion concept as well as information ... e.g. 'to accelerate' and 'to stop', a single case frame, namely that speci- tying an obligatory AGENT of type 'vehicle' and a optional LOCATIV...
Ngày tải lên: 24/03/2014, 05:21
... functions as a signal terminator for H 2 O 2 -activated phospholipase D1 Nianzhou Xiao, Guangwei Du and Michael A. Frohman Department of Pharmacology and the Center for Developmental Genetics, ... plasma membrane, which is also required for NADPH activation [9,10]. Once NADPH oxidase is activated, it generates H 2 O 2 , which can func- tion to kill intracellular bacteria and play pro-a...
Ngày tải lên: 20/02/2014, 01:20
... Sequence TC4 CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGG TC6 CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG TC8 CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGG TC10 CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGG TG6 CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG TG8 CGGTCCTAGTACTC...
Ngày tải lên: 20/02/2014, 03:20
Báo cáo khoa học: "Case markers and Morphology: Addressing the crux of the fluency problem in English-Hindi SMT" pot
... gaandhii darshana va gaandhii raashtriiya san- grahaalaya raajaghaata men hai Semantic: я gaandhii darshana va gaandhii raashtriiya san- grahaalaya ... analysis gloss: waterway Alappuzha of most popular picnic spot of one is Semantic: a я a e antahsthaliiya jalamaarga aalapuz...
Ngày tải lên: 08/03/2014, 00:20
Báo cáo khoa học: "Regular tree grammars as a formalism for scope underspecification" docx
... com- pact representation of a set of trees in the same way that a parse chart is a compact representation of the set of parse trees of a context-free string grammar. Note that each tree can be ... represent arbitrary subsets of the original set of readings. Ebert shows that the classical dominance- based underspecification formalisms, such as MRS, Hole Semantics, and do...
Ngày tải lên: 23/03/2014, 17:20
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx
... time that this method has been applied in dialectometry. 3 Aggregate Analysis In the first phase of this project L04 toolkit was used in order to make an aggregate analysis of Bulgarian dialects. ... multidi- mensional scaling. The analyses showed that results obtained using aggregate analysis of word pronunci- ations mostly conform with the traditional phonetic classification of Bulgar...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf
... WSD BabelNet API. BabelNet can be effectively ac- cessed and automatically embedded within applica- tions by means of a programmatic access. In order to achieve this, we developed a Java API, based ... research on the topic has explored the translation of sentences into many languages (Navigli and Ponzetto, 2010; Lefever et al., 2011; Banea and Mihalcea, 2011), as well as the proj...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc
... journal. Each document was morphologically analyzed and lem- matized (Hajiˇc, 2000) and then indexed and rep- resented as a vector. We indexed only lemmas of nouns, adjectives, verbs, adverbs and ... locally optimal. 2.3 Local optimization of cuts A cut is called locally optimal regarding quality function if each cut which is only a small modification of the original does not hav...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "Automatic English-Chinese name transliteration for development of multilingual resources" pdf
... historical interactions of some European and Asian nations has lead to names that include some special meaning. Interaction with the dialects of the South may have produced transliterations based ... such words as "Unitear" are translated and not transliterated ~, we pass the entire PNP into a dictionary in search of a standard translation. If a match is not imme...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: "Evaluating Response Strategies in a Web-Based Spoken Dialogue Agent" pdf
... Task 1 was the easiest, it was always performed first. The order of the remaining tasks was randomized across users. 782 Task LT Strategy Exact-Match Say it No-Match-1 Say No Match No-Match-2 ... earlier train leaves at 9:28 am ever), da3; and it takes I day 3 hours 36 rains. The closest later train leaves at 11:45 ant on Saturday and Sunda3; and it takes 22 hours 5 rains. Please s...
Ngày tải lên: 17/03/2014, 07:20