Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

... the total amount of SLP-76 in the CD3 treated lanes. The 75-kDa protein comigrated exactly with SLP-76. These results indicate that both the SH2 domain and the PTB- Tyr region of Shb, are vital ... mutation in the SH2 domain affects the co-immunoprecipitation of several tyrosine phosphorylated proteins To further investigate the protein-interactions of the Shb...

Ngày tải lên: 24/03/2014, 04:21

10 409 0
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"

Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"

... community pharmacists might be the only point of contact when they had minor aliments. Therefore, there is a need in promoting and extending the roles of the western medicine com- munity pharmacists ... medications. Patterns of OTC uses reflect the characteristics of populations who rely on community pharma- cists and Chinese medicine retailers as their main point of contact wi...

Ngày tải lên: 25/10/2012, 10:06

9 517 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

... 180 ccgacctcagGCCTC CATAGgtgacacctc 9 145 1 Mouse 10 117 ctctttgcagGTTGG GTTTGgtaagtatct 10 681 1 Human 10 114/126 d cttgtttcagGTCGC GTTGGgtgatctcaa 10 801 1 Mouse 11 120 ttcttcacagATGAG GCCCGgtgagcatca ... within the repeat region (see further) to obtain the cDNA corresponding to the end of the repeat region. The sense oligonucleotide NAU972 (5¢-GAGCTGC CTGTGTTCTTGCCTCCT-3¢) was de...

Ngày tải lên: 08/03/2014, 23:20

10 435 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

... of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), ... protein. The results suggest that the m odified pin in uences the a bility to bind duplex DNA and is consistent with observations by Ingleston et al. [12] showing that mutations in E...

Ngày tải lên: 17/03/2014, 17:20

9 542 0
Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx

Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx

... perturbation of the electronic absorbance properties of the chromophore without affecting the coordination number or the spin state of the haem-iron, and the quenching of the 1 H-NMR relaxivity. ... linked by extended random coils. It is thus reasonable to hypothesize allosteric conformational tran- sition(s) occurring in HSA upon ligand binding. Note that the flexibility o...

Ngày tải lên: 31/03/2014, 23:20

7 550 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

... ribozyme in Mn 2+ is that binding of the cosubstrate to its site induces a conformational change in the RNA that inhibits Mn 2+ binding at another inhibitory site(s). It may be relevant that in vitro-evolved ... trans- reaction [10] that involves the free intron reacting with 5.8S rRNA (not shown). Together, these data sugges- ted that inhibition by Mn 2+ probably involved the...

Ngày tải lên: 19/02/2014, 07:20

14 480 0
Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"

Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"

... The incidence rates in the Netherlands have only fluctuated around the same level since the early 1990 s. Yet, mor- tality has been steadily declining [1]. The burden of stroke in the Netherlands is ... as defined ex ante, and was the only one cost-effective in the first six months after stroke in the EDISSE trial, while the other did not comply to these criteria...

Ngày tải lên: 25/10/2012, 10:35

10 569 0
Báo cáo y học: "2009 H1N1 Influenza and Experience in Three Critical Care Unit"

Báo cáo y học: "2009 H1N1 Influenza and Experience in Three Critical Care Unit"

... time from the onset of illness to the initiation of antiviral therapy was 7.4±4.17 days (range, 1 to 22 days); 2 of the patients received anti- viral therapy within 48 hours after the onset ... findings are consistent with these reports. In our data and in other studies, death was occurred mostly young critically ill patients (1, 13, 14). But, the risk of death increase...

Ngày tải lên: 25/10/2012, 11:04

8 422 0
Báo cáo y học: "Long Term Persistence of IgE Anti-Influenza Virus Antibodies in Pediatric and Adult Serum Post Vaccination with Influenza Virus Vaccine"

Báo cáo y học: "Long Term Persistence of IgE Anti-Influenza Virus Antibodies in Pediatric and Adult Serum Post Vaccination with Influenza Virus Vaccine"

... al- lergy to egg and antibiotics. At the time of study, the subjects had not received allergy therapy, and were not being treated with any medication. Subjects did not have a past history of ... able to mediate antibody depend- ent cell mediated cytotoxicity against cancer cells in vitro. These responses were not correlated with total serum IgE levels. We therefore specul...

Ngày tải lên: 25/10/2012, 11:10

6 599 1
w