Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx
Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx
... the total amount of SLP-76 in the CD3 treated lanes. The 75-kDa protein comigrated exactly with SLP-76. Theseresults indicate that both the SH2 domain and the PTB-Tyr region of Shb, are vital ... mutation in the SH2domain affects the co-immunoprecipitation of severaltyrosine phosphorylated proteinsTo further investigate the protein-interactions of the Shb adapter protein, we attempted ... thusbrought in proximity to the tyrosine kinase ZAP70.Introduction of the Shb SH2 point mutation decreases the ability of the Shb LAT–SLP76 Vav complex to interact with ZAP70. In addition, expression...
- 10
- 408
- 0
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"
... community pharmacistsmight be the only point of contact when they hadminor aliments. Therefore, there is a need in promoting and extending the roles of the western medicine com-munity pharmacists ... medications. Patterns of OTC uses reflect the characteristics of populations who rely on community pharma-cists and Chinese medicine retailers as their main point of contact with the healthcare system. ... community pharmacists, wecontend that the role of community pharmacists in pri-mary care must not be underestimated. This is vividlyillustrated by the fact that 9.4% of the respondents hadno...
- 9
- 516
- 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... 180ccgacctcagGCCTC CATAGgtgacacctc 9 145 1Mouse 10 117ctctttgcagGTTGG GTTTGgtaagtatct 10 681 1Human 10 114/126dcttgtttcagGTCGC GTTGGgtgatctcaa 10 801 1Mouse 11 120ttcttcacagATGAG GCCCGgtgagcatca ... within the repeat region (see further) toobtain the cDNA corresponding to the end of the repeatregion. The sense oligonucleotide NAU972 (5¢-GAGCTGCCTGTGTTCTTGCCTCCT-3¢) was designed from the sequence ... 165atgtgctcagTTCAC ATCAGgtgagccttt 5 1629 0Mouse 6 156 cctttcctagGAATA TTGGGgtgagtggat 6 1102 0Human 6 156cctttcctagGAATA TCGGGgtgagtagac 6 1063 0Mouse 7 131caacttccagACCAA TCCAGgtaagatcgg...
- 10
- 434
- 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... ofone strand: 1 (bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT),2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), ... protein. The results suggest that the m odified pin in uences the a bility tobind duplex DNA and is consistent with observations byIngleston et al. [12] showing that mutations in EcRuvA thatreduce ... Holliday junctionTo investigate the effect of these alterations in pin structureon the DNA binding properties of RuvA we purified the Mycoplasma pneumoniae RuvA protein and compared itsactivity with...
- 9
- 542
- 0
Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx
... perturbation of the electronic absorbanceproperties of the chromophore without affecting the coordination number or the spin state of the haem-iron, and the quenching of the 1H-NMR relaxivity. ... linked by extended random coils. It is thusreasonable to hypothesize allosteric conformational tran-sition(s) occurring in HSA upon ligand binding. Note that the flexibility of the HSA structure ... allows it to adaptreadily to ligands and that its three-domain design providesa variety of binding sites. In particular, the conformationaladaptability of HSA involves more than the immediateCorrespondence...
- 7
- 549
- 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... ribozyme in Mn2+is that binding of the cosubstrate to its site induces a conformationalchange in the RNA that inhibits Mn2+binding atanother inhibitory site(s). It may be relevant that in vitro-evolved ... trans-reaction [10] that involves the free intron reacting with 5.8S rRNA (not shown). Together, these data sugges-ted that inhibition by Mn2+probably involved the core ribozyme, and not the intron ... sites. Hence, it may be that they bind to the samebasic locations, but that Mn2+binds with slightly dif-ferent configurations at some key sites, resulting in inhibition. In this respect, it...
- 14
- 480
- 0
Báo cáo y học: "Lifetime health effects and medical costs of integrated stroke services - a non-randomized controlled cluster-trial based life table approach"
... The incidence rates in the Netherlands have only fluctuatedaround the same level since the early 1990 s. Yet, mor-tality has been steadily declining [1]. The burden of stroke in the Netherlands is ... asdefined ex ante, and was the only one cost-effective in the first six months after stroke in the EDISSE trial,while the other did not comply to these criteria and showed indifferent results ... [14]. The control settings reflected the usual stroke care in The Netherlands at the time (e.g. concerning case load,length of stay and extent of illness). In some settingsstroke units were...
- 10
- 568
- 0
Báo cáo y học: "2009 H1N1 Influenza and Experience in Three Critical Care Unit"
... time from the onset of illness to the initiation of antiviral therapy was 7.4±4.17 days (range, 1 to 22 days); 2 of the patients received anti-viral therapy within 48 hours after the onset ... findings are consistent with these reports. In our data and in other studies, death was occurred mostly young critically ill patients (1, 13, 14). But, the risk of death increased with increasing ... increasing age. Importantly, severity of illness and mortality in our cohort are similar to that demonstrated previously with novel H1N1. The first data from Mexico showed that most of the patients...
- 8
- 421
- 0
Báo cáo y học: "Long Term Persistence of IgE Anti-Influenza Virus Antibodies in Pediatric and Adult Serum Post Vaccination with Influenza Virus Vaccine"
... al-lergy to egg and antibiotics. At the time of study, the subjects had not received allergy therapy, and were not being treated with any medication. Subjects did not have a past history of ... able to mediate antibody depend-ent cell mediated cytotoxicity against cancer cells in vitro. These responses were not correlated with total serum IgE levels. We therefore speculate that it is ... not the total IgE levels that are important but rather the fraction of IgE anti-influenza antibodies as a percent-age of the total IgE pool that are responsible for me-diating any effects....
- 6
- 598
- 1
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyendetermination of metal interactions with the chaperone hspa5 in human astrocytoma cells and rat astrocyte primary culturesbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP