Báo cáo Y học: Isolation and characterization of MUC15, a novel cell membrane-associated mucin pot
... pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTTATCTGAGTTTA-3¢. c Primer pair: 5¢-CATCCATAGCAGATAACAGTC-3¢ and ... Two alternative poly (A) signals [A( 1259)TAAA and A( 1430)ATTAAA] giving rise to poly (A) tails were observed by PCR-screening of the bovine mammary gland cDNA library. The N-terminal...
Ngày tải lên: 24/03/2014, 04:21
... nucleospin extract k it (Macherey±N agel), then digested by NcoIand BamHI, and cloned i nto the pET-8c vector. Screening of a cDNA library A kgt11 cDNA library of Chlamydomonas was a gift from M. ... protein and with BSA (400 lgámL )1 ). The reactions were stopped by adding 3.3 m M EDTA and analyzed on an agarose gel. Thioredoxin-dependent peroxidase activity of Ch-Prx1 Pero...
Ngày tải lên: 08/03/2014, 16:20
... Interestingly, P II was the only isoform with affinity for rhamnose. As a result, P II lacked the galactose and ⁄ or N-acetyl galactosamine specificity that is a characteristic feature of the archetypal type ... galactose and galactose-containing structures, can agglutinate human and rabbit erythrocytes, and kills mice and the microcrustacean Artemia salina at very low concentra...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx
... 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢ Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense ... 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢ Tyr183Phe Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢ Anti-sense strand 5¢-C...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx
... Kawakami B, Yamano H, Hosono H, Tani Y & Yamada H (1982) 3-chloro-d-ala- nine chloride-lyase (deaminating) of Pseudomonas putida CR 1–1. Purification and characterization of a novel enzyme ... pyridoxal-5¢-phosphate (PLP)-dependent enzymes that catalyse elimination and replacement reactions of amino acids have been purified and characterized [6]. Keywords 1-aminocyclopro...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using V NAR terminal oligonucleotide ... variant of 12F-11 incorporating mutations Cys22Ala and Cys82Val was constructed by overlapping PCR using oligonucleotid...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc
... Conus carboxylase and vertebrate vitamin K-dependent c-carboxylases argue for conservation of a vitamin K-dependent carb- oxylase across animal species and the importance of c-carboxyglutamic acid ... (Grand Island, NY, USA). RACE kits and Advantage cDNA polymerase mix were from Clontech (Palo Alto, CA, USA). AmpliTaq Gold polymerase and buffer were from Perkin–Elmer (Branchburg...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Cloning and characterization of novel snake venom proteins that block smooth muscle contraction pptx
... Hishinuma 2 , Mitsuo Mita 2 and Takashi Morita 1 Departments of 1 Biochemistry; and 2 Pharmacodynamics, Meiji Pharmaceutical University, Tokyo, Japan In this study, we isolated a 25-kDa novel snake ... doi:10.1046/j.1432-1033.2002.02940.x purchased from Seikagaku Corporation (Tokyo, Japan). Other chemicals were of analytical grade (Sigma–Aldrich, Amersham–Pharmacia Biotech., Wako...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf
... Trx/TR system of the aerobic archaea. MATERIALS AND METHODS Materials The plasmid pET-3d was purchased from Novagen (Madison, WI, USA). KOD DNA polymerase and T 4 DNA polymerase were purchased from ... Identification and characterization of thioredoxin and thioredoxin reductase from Aeropyrum pernix K1 Sung-Jong Jeon and Kazuhiko Ishikawa National Institute of Advanced Indust...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Cloning and characterization of the mammalian-specific nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc
... and characterization of the mammalian-specific nicolin 1 gene ( NICN1 ) encoding a nuclear 24 kDa protein Bianca Backofen 1, *, Ralf Jacob 2, *, Katrin Serth 3 , Achim Gossler 3 , Hassan Y. Naim 2 and ... XhoI/SacI subfragment from the murine IMAGE 1349406 clone and T7-RNA poly- merase (Roche, Mannheim Germany). A sense RNA probe using T3-RNA Polymerase (Roche, Mannheim, Germany...
Ngày tải lên: 23/03/2014, 21:20