... sighted by the first discoverer the Italian Cabot was spoken of under the Italian name of Prima Terra Vista. The name Baccalaos[24] tells of voyages of the Basques, as Cape Breton of visitors from ... writers. At the present day, on the maps of Newfoundland, an islet off the east coast, at the extreme north of the peninsula of Avalon, bears the name of...
Ngày tải lên: 24/03/2014, 03:21
... catalytic pockets in the asymmetric unit, and the glutamate-binding modes are identical to each other (Fig. 2A) . The a- carboxyl and a- amino groups of the bound glutamate are at the bottom of the pocket, ... was amplified by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢- CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢-...
Ngày tải lên: 22/03/2014, 21:20
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... is that the cyclical behavior of the ratings reflects the sensitivity of the various financial ratios on which they are based. 16 Hickman voiced concern about the cyclical behavior of agency-ratings ... owners of financial assets, the institutions (both public and private) that guarantee the assets, and the asset managers that act as agents for the principals o...
Ngày tải lên: 16/02/2014, 03:20
A Brief History of the English Language and Literature, Vol. 2 doc
... contribution came to us by the aid of the Revival of Learning rather a process than an event, the dates of which are vague, but which may be said to have taken place in the sixteenth and seventeenth ... to adjectives, verbs, and other parts of language. The causes of this are not far to seek. Spoken language can never be so accurate as written language; the mass of...
Ngày tải lên: 17/03/2014, 02:20
An Historical Account Of The Rise And Progress Of The Colonies Of South Carolina And Georgia, Volume 1 pot
... than the next An Historical Account of the Rise and Progress of the Colonies of South Carolina and Georgia, vol 119 An Historical Account of the Rise and Progress of the Colonies of South Carolina ... Team AN HISTORICAL ACCOUNT OF THE RISE AND PROGRESS OF THE COLONIES OF SOUTH CAROLINA AND GEORGIA. In Two Volumes. VOL. I. By ALEXANDER HEWATT An...
Ngày tải lên: 17/03/2014, 16:20
A quarterly bulletin of the IEEE computer society technical committee on Database engineering (VOL. 8) ppt
... and “where.” The Do-specialist replaces the predicate DO (from the verb “do”) with a more specific verb chosen from those acquired for a domain. Although “do” does not appear as the main verb very often in the database query task , the translators deduce its implied presence in some queries—for instance in such comparative questions as “What countries cover more area than Peru...
Ngày tải lên: 30/03/2014, 22:20
A quarterly bulletin of the IEEE computer society technical committee on Database engineering (VOL. 9) pptx
... the definitions of the complex object types. We will present, in particular, the techniques used in the ESPRIT project MULTOS. In this project, a data server has been implemented in which data objects are constituted by multimedia documents with complex internal structures. 1. Introduction Many applications, such as office information systems (OIS), particularly filing and retriev...
Ngày tải lên: 30/03/2014, 22:20
DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANOI, VIETNAM
... strategy or competitive strategy refers to the plan of actions that management adopt to use a company’s resource and its distintive ability to gain a competitive advantage over its rivals in a ... Analysis Alternative strategies Strategy evaluation Recommended strategy Recommendation DEVELOPING A COMPETITIVE STRATEGY: A CASE STUDY OF THE THANGLONG GARMENT COMPANY IN HANO...
Ngày tải lên: 23/04/2013, 10:29