Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx
... What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information Darren Gergle Human-Computer Interaction Institute School of Computer ... referring behavior in shared visual contexts. First, a model of refer- ring behavior that integrates a component of shared visual information c...
Ngày tải lên: 24/03/2014, 03:20
... discovered as one of the autoantigens for the autoantibodies from a patient with collagen vascular disease [18]. MAN1 is an integral membrane protein of the INM and belongs to the LEM (Lap2- emerin-MAN1)-domain ... WH domain binds DNA with nanomolar affinity and the binding is further increased by the presence of the UHM domain [44]. Because the DNA binding site on...
Ngày tải lên: 19/02/2014, 02:20
... Events, and Relations An important property of a natural language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. ... Since contexts are introduced as a new class of objects in the language, we can quantify over them and otherwise talk about them. In particular, we can organize contex...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... [70]. In all of the cases described above, mainly histidyl– FAD-containing enzymes, it appears that the func- tional benefit of acquiring and retaining a covalent flavin–protein link is to increase the ... artifi- cial covalent flavinylation (again, FAD is linked via an 8-carbon rather than 8a- carbon linkage) resulted in an increased k cat value with d-alanine from 1.5 s )1 for...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: It’s cheap to be colorful Anthozoans show a slow turnover of GFP-like proteins potx
... been found as major colorants in the scleractinian corals M. cavernosa, Scolymia cubensis, Catalaphyllia jardinei, the corallimorpharian Ricordia florida and the alcyo- narian Dendronepthya sp. [10,12,27]. ... suggest that the animals face considerable energy costs maintaining such high expression levels, at least, if protein turnover is fast. To date, no kinetic data are available...
Ngày tải lên: 30/03/2014, 09:20
Báo cáo khoa học: "Combining Multiple Resources to Improve SMT-based Paraphrasing Model∗" pdf
... phrases to alleviate data sparseness. Kauchak and Barzilay (2006) used paraphrases of the reference translations to improve automatic MT evaluation. In QA, Lin and Pantel (2001) and Ravichandran ... syntactic and context constraints in paraphrase generation to enhance the acceptability of the paraphrases. In ad- dition, we will extract paraphrase patterns that con- tain...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx
... NEMO adaptor bridges the nuclear factor-kappaB and interferon regulatory factor signaling pathways. Nat Immunol 8, 592–600. 73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C ... trimers in the plasma mem- brane early after receptor ligation whereas the cell death regulators FAS-associated via death domain (FADD) and caspase 8 are recruited to a pro-apopto- t...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation pro- file above the HST, the total area (the HST being the zero axis) and the area above the HST of each ... acid at each position is the logarithm of the ratio of its frequency in the training set and the background database). As there is a positive and a...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf
... ACT CAAGGGATTGTAGCCTTCCGGCAGCATCTACAG AATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAG GAACCCCTTGGTCCTCGCGAGATTCTGTAGAT GCTGCCGGAAGGCTACAATCCCTTGAGTGAGA GACGTATC and 5¢-GATACGTCCCTTACACAAG GACTTAAGGCATTTAGACAACAGCTTCGGAAG AATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAA TCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTG TCTAAATGCCTTAAGTCCTTGTGTAAGGGACG TATC, ... 5¢-GCGAGG ACCAAGGGGATTCTGGAGCTGAACAAGGTGC AATTGTTGTACGAACAGGTGTGCCAGTCCTCC...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: "That’s What She Said: Double Entendre Identification" doc
... cap- italizing the first letter of each sentence, tagging it with the Stanford Parser (Toutanova and Manning, 2000; Toutanova et al., 2003), and fixing several tag- ger errors (e.g., changing the tag of ... classifier. DEviaNT sets the cost of a false positive to be 100 times that of a false negative. 4 Evaluation The goal of our evaluation is somewhat unusual. DEviaNT...
Ngày tải lên: 07/03/2014, 22:20