Báo cáo khoa học: "The Derivation of a GrammaticaUy Indexed Lexicon from the Longman Dictionary of Contemporary English" pptx
... The Derivation of a GrammaticaUy Indexed Lexicon from the Longman Dictionary of Contemporary English Bran Boguraev t, Ted Briscoe§, John Carroll t, David Carter t and Claire Grover§ ... accurate) information. Finally, we evaluate the utility of the Longman Dictionary of Contemporary EnglgsA as a suitable source dictionary for the target lexicon...
Ngày tải lên: 24/03/2014, 02:20
... hybridization. Proc Natl Acad Sci USA 80, 3734–3737. 31 Grewal S, Ponnambalam S & Walker JH (2003) Asso- ciation of cPLA2-alpha and COX-1 with the Golgi apparatus of A5 49 human lung epithelial cells. ... pivotal role in the generation of arachidonic acid from mem- brane phospholipids. As this arachidonic acid is the precursor for prostacyclin, a member of the eicosan...
Ngày tải lên: 16/03/2014, 18:20
... improve the performance of the statisti- cal approach if larger n-gram models are avail- able. We further show that the performance of the knowledge-based approach can be improved by using semantic ... for an evaluation targeted at finding optimal measures of contextual fitness, as they over-estimate the performance of statistical measures while underestimating the potential...
Ngày tải lên: 17/03/2014, 22:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... that is capable of binding several different families of transcriptional activators [30], and evidence indicates that the KIX domain has the ability to simultaneously interact with at least two ... lysine methyltransferases. J Biol Chem 280, 5563–5570. 53 Qian C, Wang X, Manzur K, Sachchidanand, Farooq A, Zeng L, Wang R & Zhou MM (2006) Structural insights of the specificity a...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... mass spectrum of the isolated stromal proteins from A. thaliana with their measured molecular mass values [20]. Fig. 3. ESI mass spectrum of the isolated chloroplast proteins from A. thaliana ... modifications of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an adduct increase, or no change, the value had une...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
... 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢. Western blot Cells were rinsed in NaCl ⁄ P i , trypsinized and ... and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c:5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthase subunit b:5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢- TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCC...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... is an RNA-mediated oligomer. Nucleic Acids Res 32, 1325– 1334. 5 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y, Nagahama Y & Yamashita M (2003) Involvement of Xenopus Pumilio in the translational ... II, France Translational regulation of mRNA is often linked to the control of the poly (A) tail length, as its cytoplasmic lengthening can stabilize mRNA and activate transla-...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev- Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. The ... respectively, as a direct electron acceptor. The animal and plant l-gul- onolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate. Only scarce data are avail...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... min after synthesis. The maturation of these late forming epitopes is accompanied by a further maturation of epitopes A2 and A5 . After 25 min of chase, precipitation with mAbs A2 and A5 is almost ... the biochemical effects of the corresponding amino acid substitutions on ASA. In a number of mutants, the amino acid substitution causes an arrest of ASA in the ER...
Ngày tải lên: 07/03/2014, 17:20