Báo cáo khoa học: "The Derivation of a GrammaticaUy Indexed Lexicon from the Longman Dictionary of Contemporary English" pptx

... The Derivation of a GrammaticaUy Indexed Lexicon from the Longman Dictionary of Contemporary English Bran Boguraev t, Ted Briscoe§, John Carroll t, David Carter t and Claire Grover§ ... accurate) information. Finally, we evaluate the utility of the Longman Dictionary of Contemporary EnglgsA as a suitable source dictionary for the target lexicon. 1 Introduction Within the ... extracted from LDOCE demonstrates that much of the information available from LDOCE is of direct utility for example the SUBCAT values can be derived by an analysis of the Takes values and the...

Báo cáo khoa học: Cytosolic phospholipase A2-a and cyclooxygenase-2 localize to intracellular membranes of EA.hy.926 endothelial cells that are distinct from the endoplasmic reticulum and the Golgi apparatus pdf

... hybridization. Proc Natl Acad SciUSA 80, 3734–3737.31 Grewal S, Ponnambalam S & Walker JH (2003) Asso-ciation of cPLA2-alpha and COX-1 with the Golgiapparatus of A5 49 human lung epithelial cells. ... pivotalrole in the generation of arachidonic acid from mem-brane phospholipids. As this arachidonic acid is the precursor for prostacyclin, a member of the eicosanoidfamily of inﬂammatory mediators, ... phospholipase A 2 -a (cPLA2 -a) is a calcium-activated enzyme thatplays an important role in agonist-induced arachidonic acid release. Inendothelial cells, free arachidonic acid can be converted...

Báo cáo khoa học: "Measuring Contextual Fitness Using Error Contexts Extracted from the Wikipedia Revision History" pptx

... improve the performance of the statisti-cal approach if larger n-gram models are avail-able. We further show that the performance of the knowledge-based approach can be improvedby using semantic ... for an evaluation targeted atﬁnding optimal measures of contextual ﬁtness, asthey over-estimate the performance of statisticalmeasures while underestimating the potential of semantic measures. ... evaluate – a clearly unacceptable bias. Thus, a cer-tain amount of manual validation is inevitable.531‘goal’ was changed by some Wikipedia editor to‘jail’. However, actually it should have...

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... that is capable of binding severaldifferent families of transcriptional activators [30], andevidence indicates that the KIX domain has the abilityto simultaneously interact with at least two ... lysinemethyltransferases. J Biol Chem 280, 5563–5570.53 Qian C, Wang X, Manzur K, Sachchidanand, Farooq A, Zeng L, Wang R & Zhou MM (2006) Structuralinsights of the speciﬁcity and catalysis of a viralhistone ... provide a picture of how the recruitment of MLL1 can increase the binding of other important transcriptional activators that ulti-mately could result in the synergistic activation of genetranscription....

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... mass spectrum of the isolatedstromal proteins from A. thaliana with theirmeasured molecular mass values [20].Fig. 3. ESI mass spectrum of the isolated chloroplast proteins from A. thaliana ... modiﬁcations of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an adduct increase, orno change, the value had unexpectedly decreased from 22 ... mod-iﬁcations [42].Fig. 9. ECD spectral data from the RNase A deamidation samples of Fig. 8. Deamidation at an individual residue of a speciﬁc product causes a 1 Da increase in any fragment...

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-back (5¢-CTCTACATGCATTTCAACAATAGGGCCTGTC-3¢) ... (5¢-TGGTACTCGAGCAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GGAAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) anddownstream to pyk using primer pyk3 (5¢-GGAAGGATCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) wereampliﬁed. ... strain CS1897which already contains an additional copy of the pyk geneat the TP901-1 phage attachment site. PCR productsupstream to pyk using primer pyk1 (5¢-TGGTACTCGAGCAATTTCTGAAGGTATCGAAG-3¢)...

Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx

... 5¢-TAACCCCACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGATTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCACC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢.Western blotCells were rinsed in NaCl ⁄ Pi, trypsinized and ... and 5¢-GTGTTTCAGGGCTTCTCTGC-3¢; Cyt c:5¢-CCAGTGCCACACCGTTGAA-3¢and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP synthasesubunit b:5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢-TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCCACCCTACTAAACC-3¢ ... USA). Data were normalized to b-globin. The sequences of the primers used in this study were as fol-lows: ERRa:5¢-AAGACAGCAGCCCCAGTGAA-3¢ and5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGGTTGACCCTGTTCCT-3¢...

Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

... is anRNA-mediated oligomer. Nucleic Acids Res 32, 1325–1334.5 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y,Nagahama Y & Yamashita M (2003) Involvement of Xenopus Pumilio in the translational ... II, FranceTranslational regulation of mRNA is often linked to the control of the poly (A) tail length, as its cytoplasmiclengthening can stabilize mRNA and activate transla-tion. During early ... J & WickensM (2004) Mammalian GLD–2 homologs are poly (A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412.18 Nakanishi T, Kubota H, Ishibashi N, Kumagai S,Watanabe H, Yamashita M, Kashiwabara...

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (forward), 5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev-Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. The ... respectively, as a direct electron acceptor. The animal and plant l-gul-onolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate.Only scarce data are available on the ... Vandekerckhove J, Van Montagu M,Zabeau M & Boerjan W (2001) Partial puriﬁcation andidentiﬁcation of GDP-mannose 3¢,5¢-epimerase of Ara-bidopsis thaliana, a key enzyme of the plant vitamin...

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

... min after synthesis. The maturation of these late forming epitopes is accompanied by a further maturation of epitopes A2 and A5 . After25 min of chase, precipitation with mAbs A2 and A5 is almost ... the biochemical effects of the corresponding amino acidsubstitutions on ASA. In a number of mutants, the amino acid substitution causes an arrest of ASA in the ER [2,9,10], whereas others can leave the ... on the stability of amino acid-substituted ASAsIn order to elucidate the role of trimming reactions of the N-linked oligosaccharide side chains in ERassociated degradation of mutant ASAs, stably...

Xem thêm