Báo cáo khoa học: "BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER" docx
... memory and processor limitations. 8.1 Parallel Sorting A parallel sort is similar in function to a serial sort. It accepts as arguments a parallel data field and a par- allel comparison predicate, ... variables are called parallel variables, or parallel fields. When a host computer program per- forms a serial operation on a parallel variable, that op- eratio...
Ngày tải lên: 24/03/2014, 02:20
... 5¢-CCAG AACGTTATGTTTGCAGCTGCACTGAAGCTGCCTGC-3¢ (for the TED58AAA mutant: R54N, T5 8A, E5 9A, D6 0A) ; 5¢-CCCAGAACGTTATGGCTGCAGCTGCACTGAAGC TGCCTG-3¢ (for the FTED57AAAA mutant: R54N, F5 7A, T5 8A, E5 9A, ... 5¢-CCAGAACGTTA TGTTTGCACTGAAGCTGCCTGC-3¢ (for the T58ADED mutant: R54N, T5 8A, deletion of E59 and D60); 5¢-GAAC GTTATGTTTACCGCAGCTCTGAAGCTGCCTGC-3¢ (for the ED59AA mutant: R54N, E5 9A,...
Ngày tải lên: 07/03/2014, 03:20
... JAPAN {kakegawa,kanda,eitaro76,itami,itoh}@itlb.te.noda.sut.ac.jp Abstract As an application of NLP to computer-assisted language learn- ing(CALL) , we propose a diag- nostic processing of Japanese ... dependency grammar ”(M.Nagao, 1996). 2 LTAG of Japanese 2.1 The Characteristic of Japanese Japanese phrases are classified in the first place into two categories: Yougen phrase(YP) an...
Ngày tải lên: 08/03/2014, 05:20
Báo cáo khoa học: "Discourse Processing of Dialogues with Multiple Threads" pot
... information in machine translation. In (Iida and Arita 1990; Kogura et al. 1990), researchers at ATR advocate an approach to machine transla- tion called illocutionary act based translation, argu- ... State-Constraint. And any State-Constraint can attach to the active path as a confirmation be- cause the constraints on confirmation attachments are very weak. Since State-Constraint i...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: "EFFICIENT PROCESSING OF FLEXIBLE CATEGORIAL GRAMMAR" potx
... Throughout this paper we will be us- ing the notation of Lambek (1958), in which A/ B and B \A are a right-directional and a (i) application : A/ B B ==> A B B \A ==> A composition: A/ B B/C ... generative grammar is that coordination always takes place between between constituents. Right- node raising constructions and other in- stances of non-constituent con...
Ngày tải lên: 24/03/2014, 05:21
Báo cáo khoa học: "Automatic Detection of Text Genre" doc
... cost of training on a large set of cues. Variation measures capture the amount of varia- tion of a certain count cue in a text (e.g the stan- dard deviation in sentence length). This type of ... genres as bundles of facets, we can categorize this genre as INSTITUTIONAL (because of the use of we as in edi- torials and annual reports) and as NON-SUASIVE or non...
Ngày tải lên: 31/03/2014, 21:20
Báo cáo khoa học: "VARIOUS REPRESENTATIONS OF TEXT PROPOSED FOR EUROTRA" docx
... a human partner. In this table, we also indicate the alphabe- tical order of each Language. Each Language has its own characteristics ; in French, for example, dictionaries are sorted according ... sublanguage. Hence, a "title" format may be used by the analyzer to use an appropriate subgramma~ - how alphabetical transcriptions are carried out. No coding standards exis...
Ngày tải lên: 01/04/2014, 00:20
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... 4919 Proteomic analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia ... neu- rons of the substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronal death is accompanied by the appearance of Lewy bodies (LB)...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc
... Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al. (2003) Genome sequence of Bacillus cereus and comparative analysis with ... allowed regions of a Ramachandran plot. Asp14 is the only BcZBP residue that adopts an energetically unfavorable main chain conformation through which a close approach of the si...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific ... 8...
Ngày tải lên: 19/02/2014, 02:20