Báo cáo khoa học: "BULK PROCESSING OF TEXT ON A MASSIVELY PARALLEL COMPUTER" docx

... memory and processor limitations. 8.1 Parallel Sorting A parallel sort is similar in function to a serial sort. It accepts as arguments a parallel data field and a par- allel comparison predicate, ... variables are called parallel variables, or parallel fields. When a host computer program per- forms a serial operation on a parallel variable, that op- eratio...

Ngày tải lên: 24/03/2014, 02:20

... 5¢-CCAG AACGTTATGTTTGCAGCTGCACTGAAGCTGCCTGC-3¢ (for the TED58AAA mutant: R54N, T5 8A, E5 9A, D6 0A) ; 5¢-CCCAGAACGTTATGGCTGCAGCTGCACTGAAGC TGCCTG-3¢ (for the FTED57AAAA mutant: R54N, F5 7A, T5 8A, E5 9A, ... 5¢-CCAGAACGTTA TGTTTGCACTGAAGCTGCCTGC-3¢ (for the T58ADED mutant: R54N, T5 8A, deletion of E59 and D60); 5¢-GAAC GTTATGTTTACCGCAGCTCTGAAGCTGCCTGC-3¢ (for the ED59AA mutant: R54N, E5 9A,...

Ngày tải lên: 07/03/2014, 03:20

... JAPAN {kakegawa,kanda,eitaro76,itami,itoh}@itlb.te.noda.sut.ac.jp Abstract As an application of NLP to computer-assisted language learn- ing(CALL) , we propose a diag- nostic processing of Japanese ... dependency grammar ”(M.Nagao, 1996). 2 LTAG of Japanese 2.1 The Characteristic of Japanese Japanese phrases are classified in the first place into two categories: Yougen phrase(YP) an...

Ngày tải lên: 08/03/2014, 05:20

... information in machine translation. In (Iida and Arita 1990; Kogura et al. 1990), researchers at ATR advocate an approach to machine transla- tion called illocutionary act based translation, argu- ... State-Constraint. And any State-Constraint can attach to the active path as a confirmation be- cause the constraints on confirmation attachments are very weak. Since State-Constraint i...

Ngày tải lên: 08/03/2014, 07:20

... Throughout this paper we will be us- ing the notation of Lambek (1958), in which A/ B and B \A are a right-directional and a (i) application : A/ B B ==> A B B \A ==> A composition: A/ B B/C ... generative grammar is that coordination always takes place between between constituents. Right- node raising constructions and other in- stances of non-constituent con...

Ngày tải lên: 24/03/2014, 05:21

... cost of training on a large set of cues. Variation measures capture the amount of varia- tion of a certain count cue in a text (e.g the stan- dard deviation in sentence length). This type of ... genres as bundles of facets, we can categorize this genre as INSTITUTIONAL (because of the use of we as in edi- torials and annual reports) and as NON-SUASIVE or non...

Ngày tải lên: 31/03/2014, 21:20

... a human partner. In this table, we also indicate the alphabe- tical order of each Language. Each Language has its own characteristics ; in French, for example, dictionaries are sorted according ... sublanguage. Hence, a "title" format may be used by the analyzer to use an appropriate subgramma~ - how alphabetical transcriptions are carried out. No coding standards exis...

Ngày tải lên: 01/04/2014, 00:20

... 4919 Proteomic analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia ... neu- rons of the substantia nigra pars compacta (SNpc) and depletion of striatal dopamine. Dopaminergic neuronal death is accompanied by the appearance of Lewy bodies (LB)...

Ngày tải lên: 15/02/2014, 01:20

... Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al. (2003) Genome sequence of Bacillus cereus and comparative analysis with ... allowed regions of a Ramachandran plot. Asp14 is the only BcZBP residue that adopts an energetically unfavorable main chain conformation through which a close approach of the si...

Ngày tải lên: 19/02/2014, 00:20

... forward TGTGAAACGCAGTCTCTTCC H1F 122 (with H1F and H1R) 12 reverse CAAGGAGCGTTAGAATCTAAAG H1R 13 long forward TCTCCAAACCAGATCTCTACAG H2F 224 (with H2F and H2R) 14 reverse GATTTAAGTGGAGCGGAATGCTA ... reverse ACGAAACCTGGCAGAGTCCAAG B6R 5 long inner reverse GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific ... 8...

Ngày tải lên: 19/02/2014, 02:20