Báo cáo khoa học: "TAG''''''''s as a Grammatical Formalism for Ceneration" doc

... Adj~g Grammars, or "TAG's', (Josh/, Levy & Takahash/ 1975; Josh/ 1983; Kroch & Josh/ 1965) we~ developed as an al~ma~ive to the aandard tyntac~ formalisms that are ... trees. As Kmch and Jmhi point out, this means that a TAG is incomplete ms an account of the structure of a natural language, e.g. a TAG grammar wW contain ~th an active and a pas...

Ngày tải lên: 24/03/2014, 02:20

... mainten- ance. Acetylcholine (ACh) appears to serve a dual role: ACh release coincides with elevated arousal as well as the onset of paradoxical sleep, also known as rapid eye Keywords anxiety; brainstem; ... Functionally, central administration of NPS increases locomotor activity in both naı ¨ ve and habituated mice. It also significantly increases wakefulness and decreases paradoxica...

Ngày tải lên: 30/03/2014, 11:20

... to lm) and stabilize just one protein and thus are gener- ally protein and disease selective, if not specific. Many of the clinically important Fabry disease-asso- ciated a- galactosidase A variants ... S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 20 Fan J-Q &a...

Ngày tải lên: 18/02/2014, 16:20

... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain antibodies are most similar to ... stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of selected pha...

Ngày tải lên: 19/02/2014, 12:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTC...

Ngày tải lên: 19/02/2014, 17:20

... be false. Actions have a number of param- eters, as well as a precondition and effect, both of which are logical formulas. When a planner tries to apply an action, it will first create an action ... without being changed by the action. Atoms are printed in boldface iff they contradict the goal. This plan can be read as a derivation tree that has one node for each action instanc...

Ngày tải lên: 20/02/2014, 12:20

... with a window of five wavenumbers, assuming that adjacent wavenumbers are highly corr elated. A population o f 3 2 solutions was built at each generation, and e valuated. The algorithm stopped a ... interclass variance and the smallest intraclass variance, and constructs a linear combination of the variables to discriminate between the classes. The rule i s constructed with training se...

Ngày tải lên: 21/02/2014, 03:20

... and Relations An important property of a natural language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. ... representation. Several arguments have been made that frame representation languages and semantic-network languages are syntactic variants of the f~st-order predicate calculus (FOPC). The typ...

Ngày tải lên: 21/02/2014, 20:20

... Klimas ˇ auskas for M.HhaI, A. S. Bhagwat for plasmid pT71 used for construction of a hybrid plasmid carrying the gene for M.EcoRII and O. V. Kirsanova for help on purification of M.EcoRII. We are ... Instruments, Piscataway, USA) and the amount of methylated DNA was determined as described [17]. Data were analyzed by linear regression using the Microcal ORIGIN 6.0 software. Fo...

Ngày tải lên: 07/03/2014, 15:20

... h; Pro136Leu, 8 h). After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum. Precipi- tated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm). ... Tyr201Cys substituted ASA with mAb C. Degradation of amino acid-substituted ASAs via the proteasome In order to investigate the degradation pathway of amino acid-substituted ASAs in...

Ngày tải lên: 07/03/2014, 17:20