Báo cáo khoa học: "FOR A DISCOVERY PROCEDURE CERTAIN PHONOLOGICAL RULES" potx
... of a rule is weakly data determined if there is a large class of grammar or rule parts that are all consistent with the available data. For example, if there are two possible analyses that ... of acquisition in terms of actual discovery procedures. Firstly, we can identify the parts of a grammar that are underspeeified with respect to the available data. Parts of a grammar o...
Ngày tải lên: 24/03/2014, 01:21
... grammars, the augmented phrase-structure grammars (APSGs), and the semantic grammars. All of them have different characteristics and different advantages. In particular APSGs offer a natural ... on a SUN workstation, as the main component of a transportable Natural Language Interface (SAIL = Sistema per I'Analisi e I'lnterpretazione del Linguaggio). Subsets of gram...
Ngày tải lên: 09/03/2014, 01:20
... Daisuke Kawahara † Yoshikiyo Kato † Tetsuji Nakagawa † Kentaro Inui † Sadao Kurohashi †‡ Yutaka Kidawara † † National Institute of Information and Communications Technology ‡ Graduate School ... page author, and informa- tion appearance (e.g., contact address, privacy policy, volume of advertisements, and images) are automatically analyzed and stored in the standard format. 4. Ex...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: "Towards a proper treatment of coercion phenomena" potx
... indebted to Anne Abeilld, Nicolas Asher, Michel Aurnague, Andrde Borillo, Annie Delaveau, Jean Marie Marandin, Jean-Pierre Mantel, Alex Lascarides, Patrick Saint-Dizier, Annie Zaenen and our referees ... dant. (21) Apr~s trois martinis, Jean se sentait bien After three martinis John was feeling well (22) * Pendant son martini, Jean a aperfu Marie During his martini John saw Mary A...
Ngày tải lên: 18/03/2014, 02:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mi...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf
... In recent years, a number of studies have inves- tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format. Conceptually,...
Ngày tải lên: 20/02/2014, 05:20
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... each paid reward. • Qualifications To improve the data quality, a HIT can also be attached to certain tests, “qualifications” that are either system-provided or created by the requester. An example ... the assign- ments have been completed. • Rewards At upload time, each HIT has to be assigned a fixed reward, that cannot be changed later. Minimum reward is $0.01. Amazon.com collects a 10...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu Báo cáo khoa học: "Archivus: A multimodal system for multimedia meeting browsing and retrieval" doc
... and retrieval Marita Ailomaa, Miroslav Melichar, Martin Rajman Artificial Intelligence Laboratory ´ Ecole Polytechnique F ´ ed ´ erale de Lausanne CH-1015 Lausanne, Switzerland marita.ailomaa@epfl.ch Agnes ... more familiar – modality for a sizeable portion of the experiment. In order to gather a useful amount of natural language data, greater care has to be taken to design the system in...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Outilex, a Linguistic Platform for Text Processing" pdf
... flexibility: a lexicon or a grammar is not a static resource. The management of lexicons and grammars implies manual con- struction and maintenance of resources in a read- able format, and compilation ... with grammars and language resource management. All Language Resources are structured in XML formats, as well as binary formats more adequate to efficient processing; the required form...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx
... provide an apt summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are investigat- ing German as well), and furthermore ... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a marker mea...
Ngày tải lên: 20/02/2014, 18:20