Báo cáo Y học: Characterization of a partially folded intermediate of stem bromelain at low pH ppt

... Characterization of a partially folded intermediate of stem bromelain at low pH Soghra Khatun Haq, Sheeba Rasheedi and Rizwan Hasan Khan Interdisciplinary Biotechnology Unit, Aligarh Muslim ... state at pH 0.8 but greater than that of the native state. Acrylamide quenching data clearly show that stem bromelain at p H 2.0 is in an u nfolded state a s compa...

Ngày tải lên: 24/03/2014, 00:21

... and crystal structures of citrate synthase [23], triose-phosphate isomerase [24], a- amylase [27,28], and that of malate dehydrogenase [31] have been published. The psychrophilic enzymes characterized ... their rates of inactivation at different temperatures [25]. Stability measurements of proteinases are complicated by autoproteolytic cleavage that may take place during unfolding....

Ngày tải lên: 21/02/2014, 01:21

... Technology and Medicine, London SW7 2AZ, UK; 2 Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, Japan Sugar conjugation is a major pathway for the inactivation and excretion of both ... has a wide substrate specificity. This is a common feature of many members of the UGT family [40,41]. Under our conditions, BmUGT1 can catalyze the glucosylation of a range...

Ngày tải lên: 22/02/2014, 04:20

... [15]. Laccase activity The routine assay for laccase was based on syringaldazine oxidation in 0.1 M phosphate buffer (pH 5.7) at 30 °C. 2,2¢-Azinobis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) and ... activity of 934 UÆmg )1 , for a final yield of 50% (Table 1). The pure LAC2 produced a single band both on a SDS/PAGE gel, at a molecular mass of approximately 65 kDa (Fig. 1A...

Ngày tải lên: 08/03/2014, 09:20

... Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family Carol Larroy, Xavier Pare ´ s and Josep ... The YCR105W gene was amplified by PCR from the genomic DNA from the S. cerevisiae S288C strain using the oligonucleotides 5¢GGC GAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGC TCTAGACTATTTAT...

Ngày tải lên: 31/03/2014, 08:20

... eukaryotes, bacteria, and archaea: is there an autoregulatory mechanism in selenocysteine metabolism? Proc. Natl Acad. Sci. USA 93, 15086–15091. 15. Saito, Y. , Hayashi, T., Tanaka, A. , Watanabe, ... Saito, Y. , Hayashi, T., Nakamura, H., Yodoi, J., Nagasawa, S. & Takahashi, K. (2002) A com- parative study on the hydroperoxide and thiol specificity of the glutathione peroxidase fam...

Ngày tải lên: 31/03/2014, 08:20

... observed rate constant, k obs ,wasevaluatedfromeachtraceandusedto calculate the association rate constant (k on ). A plot of k s as a function of ligand concentration yields a slope of the association ... cm total length. Separations were carried out at 17 or 18 kV corresponding to a current of approximately 85 lA at a capillary temperature thermostatting of 20 °C. The...

Ngày tải lên: 31/03/2014, 23:20

... 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients. Anesth Analg 2005, 101:1470-1476. 28. ... the acquisition of data. NM helped to draft the manuscript, and participated in the acquisi- tion of data. AZ participated in the coordination of the study. AAZ...

Ngày tải lên: 25/10/2012, 10:35

... with national stroke statistics in terms of age, length of hospital stay, case- fatality, functional status at discharge, and destination after discharge. The research populations compare well to ... (iv) non-related cause of death. All death, incidence and recurrences rates are stroke severity specific and based either directly on original epidemiological data or are adjusted through...

Ngày tải lên: 25/10/2012, 10:35

... pravas- tatin is open hydroxyl-acid so that its hydrophilicity is markedly higher than that of other statins. The oral bioavailability of this statin is low due to degradation in the stomach ... human carrier erythrocytes at 25 o C while table 2 display the same parameters at 37 o C. Table 1, Effect of pravastatin concentration and incubation time on the amount of pravas...

Ngày tải lên: 25/10/2012, 11:10