Production of transgenic deepwater indica rice plants expressing a synthetic Bacillus thuringiensis cryIA(b) gene with enhanced resistance to yellow stem borer docx
... lands in Asia (the river basins of Ganges– Brahmaputra of India and Bangladesh, the Irrawaddy of Myanmar, the Mekong of Vietnam and Cambodia, and the Chao Phraya of Thailand) and West Africa ... borer Mohammad Firoz Alam, Karabi Datta, Editha Abrigo, Alelie Vasquez, Dharmawansa Senadhira, Swapan K. Datta * Plant Breeding, Genetics and Biochemistry Di6ision, International Rice Re...
Ngày tải lên: 23/03/2014, 22:20
... literature, there are a number of examples of Fab Lab projects. Mikhak et al. (2002) report on projects in India, at Vigyan Ashram Fab Lab just outside the village of Pabal in Maharashtra, and at ... survey of Fab Lab business models, an interview study asking Fab Lab managers and assistants about the pain and pride of their Fab Lab, and a selection of cases describing innov...
Ngày tải lên: 23/03/2014, 10:20
... cellular toxicity. J Biol Chem 277, 26733– 26740. 52 Shinkawa T, Nakamura K, Yamane N, Shoji-Hosaka E, Kanda Y, Sakurada M, Uchida K, Anazawa H, Satoh M, Yamasaki M et al. (2003) The absence of fucose ... Tris containing 0.05% (w ⁄ v) Tween 20] and reacted with bioti- nylated AAL (Seikagakukogyo, Tokyo, Japan) at a concen- tration of 1 lgÆmL )1 or concanavalin A (Seikagakukogyo) at...
Ngày tải lên: 23/03/2014, 04:20
Nitrogen Dynamics and Biomass Production in a Vertical Flow Constructed Wetland Cultivated with Forage Rice and their Mathematical Modeling
... Forage Rice and their Mathematical Modeling Masaki SAGEHASHI*, Sheng ZHOU*, Tatsuro NARUSE**, Mari OSADA**, Masaaki HOSOMI* * Graduate School of Engineering, Tokyo University of Agriculture ... structure, half-saturation constant, rice species, etc. However, these two values are similar, and the calibrated value is thought as feasible. Table 1- Calibrated Parameter Value...
Ngày tải lên: 05/09/2013, 09:38
Production of Trichloromethylphenol from Organophosphorus Pesticide Fenitrothion by Chlorination
... KISHIDA*, Yusuke KATO*, Hirokazu TAKANASHI*, Tsunenori NAKAJIMA*, Akira OHKI*, Yuichi MIYAKE** and Takashi KAMEYA** * Graduate School of Science and Engineering Kagoshima University, Kagoshima ... JAPAN ** Graduate School of Environmental and Information Sciences, Yokohama National University, 79-7 Tokiwadai, Hodogaya-ku, Yokohama 240-8501, JAPAN ABSTRACT In this study, it was...
Ngày tải lên: 05/09/2013, 10:15
Production of hydrogen using composite membrane in PEM water electrolysis
... properties of solution-cast perfluorosulfonate ionomers. Macromolecules 1988,21 , 1334. [18] Naga Mahesh K., Sarada Prasad J., venkateswer Rao M., Himabindu V., Anjaneyulu yerramilli, Raghunathan Rao ... membrane are done by ion exchange capacity (IEC) and FT-IR. 2. Materials and methods 2.1 Materials TiO 2, NaCl, NaOH, and 10 wt% Pd on Activated carbon, RuO 2, N,N-Dimethylacetami...
Ngày tải lên: 05/09/2013, 16:11
The Use of Plant Cell Biotechnology for the Production of Phytochemicals
... DellaPenna, 2001). Analysis of a wide range of secondary metabolites has significant advantages as compared to a study of final product(s) accumulation. However, this approach may require fairly ... secondary metabolites is of great interest. In this regard, plant cell cultures can be an attractive alternative as a production system, as well as a model system, to study the...
Ngày tải lên: 25/10/2013, 05:20
Microbial Production of Amino Acids in Japan
... and ammonia and by a two-step method from maleate via fumarate. The conversion of fumarate to l-aspartate is catalyzed by aspartase and maleate to fumarate by maleate isomerase: maleate isomerase aspartase Maleate 003 Ǟ fumarate 06 Ǟ l-asparatate The ... starting material in chemical synthesis and as a starting material for medicines, cosmetics, and food additives. References 1. Dat...
Ngày tải lên: 26/10/2013, 02:20
A study of idioms containing terms for plants in english and vietnamese
... negative, neutral effect), human situations and conditions (favorable and unfavorable), human relationship and human social status… In addition, idioms having non- human implications are also ... order to understand as well as translate idioms from a language into another one, knowledge of not only linguistic aspects but also of cultural reality has to be involved. As a resu...
Ngày tải lên: 26/11/2013, 13:28
Tài liệu Báo cáo khoa học: Production of biologically active forms of recombinant hepcidin, the iron-regulatory hormone docx
... reverse GAGGAGAAGCCCGGTTATGTTTTGCAACAGATACCACACTGGGAATT GTTACAGCATTTACAGCAGAAGATGCAGATGGGGAAGTTGGTGTCCA Human hepcidin forward GACGACGACAAGATGGACACCCACTTCCCGATCTGCATTTTCTGCTG CGGCTGCTGTCATCGATCAAAGTGTGGGATGTGCTGCAAGACGTAA Human ... corresponding to the LIC sequence of pET-32Ek ⁄ LIC vector. Sequence (5¢ -to3 ¢) Primers Mouse hepcidin forward GACGACGACAAGATGGACACCAACTTCCCCATCTGCATCTTCTGCTG...
Ngày tải lên: 18/02/2014, 18:20