Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc
... the purification and catalytic proper- ties of a membrane-bound enzyme complex from C. hydro- genoformans composed of a hydrogenase and a CO dehydrogenases. The complex catalyzes the conversion of CO ... Fe-containing catalytic subunit of CO dehydrogenase. A catalytically active CooSI dimer has been previously purified and characterized from C. hydrogenofo...
Ngày tải lên: 23/03/2014, 21:20
... 4). This is a major difference of human kynureninase from other mammalian enzymes, such as rat hepatic kynureninase, and may imply that previous reports of weak activity with L -kynurenine in ... the active site and also pave the way for co-crystallization of enzyme substrate and/ or enzyme inhibitor complexes. These should allow further mechanistic investigation of the ca...
Ngày tải lên: 08/03/2014, 22:20
... Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but not syn- thetic ... D-amino acid in peptide link- age by an enzyme from frog skin secretions. Proc Natl Acad Sci USA 102, 4235–4239. 33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishiz...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing ... RTARAAYTGNCCNGCRTCYTG LP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTT LP7 AWAWALGWDDK LP8 GYHENA LP9 WPLDYFL F2 GCCACACTTCTGTCAACATCC 3RAC TTCT...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Purification and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx
... homology and ability to catalyze the conjugation of glutathione to a broad range of electrophilic substrates in animal organisms. These classes are named alpha, mu, pi, theta, sigma, kappa, zeta and ... Purification and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus Pascal Hoarau, Ginette Garello, Mauricette Gnassia-Ba...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf
... biantennary and triantennary N-glycans that are terminated by a2 ,3-linked sialic acids, a high number of which are O-acetylated. About 1/3 of the glycans carry sulfate at N-acetylglucosamine units of ... water and analysed by MALDI-TOF MS. Phosphatase treatment Dry N-glycan samples were dissolved in 50 m M ammonium bicarbonate, and 1 U of calf intestinal alkaline phosphatase...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: Purification and characterization of three galactose specific lectins from Mulberry seeds (Morus sp.) ppt
... Purification and characterization of three galactose specific lectins from Mulberry seeds ( Morus sp.) Tanzima Yeasmin, Md Abul Kashem Tang, Abdur Razzaque and Nurul Absar Department of Biochemistry, ... the family Moraceae, part of the genus Morus. It is a deep rooted perennial plant, widely distributed in Asia, Europe, Africa and Latin America in a wide range of climatic...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx
... polymerase (Stratagene) was used to amplify vanXY C usingpAT704as template with primers A (5¢-GCTA GGTCTCAATGAAC ACATTACAATT-3¢)andB(5¢-TATG GAATTCTCATG CGAACTGCCTCA-3¢) that included BsaIandEcoRI restriction ... the VanC phenotype, VanXY C must specific- ally hydrolyse D -Ala- D -Ala with minimal activity against D -Ala- D -Ser, a very different type of specificity. VanXY C , VanX-type...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Purification and properties of the extracellular lipase, LipA, of Acinetobacter sp. RAG-1 docx
... and sequence analysis of the lipase and lipase chaperone- encoding genes from Acinetobacter calcoaceticus RAG-1, and redefinition of a proteobacterial lipase family and an analogous lipase chaperone family. ... sequence analysis [6]. LipA demonstrates hydrolytic activity toward emulsions of both medium and long chain triacylglycerols (Fig. 3). Areas of olive oil and tri...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Purification and characterization of two secreted purple acid phosphatase isozymes from phosphate-starved tomato (Lycopersicon esculentum) cell cultures ppt
... various divalent metal cations and EDTA on the activity of SAP1 and SAP2. The standard assay A was used except that the phosphoenolpyruvate concentration was subsaturating (4 m M ). Enzyme activity ... Electrophoretic patterns of CNBr cleavage fragments of SAP1 and SAP2. CNBr cleavage fragments were prepared from gel slices containing 3 lgofSAP1(lane1)andSAP2(lane2)andanalyz...
Ngày tải lên: 23/03/2014, 21:20