Báo cáo khoa học: Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca pptx

... kinetic parameters K m , V max and k cat were determined for the purified AATB3. Values for K m and V max for both amino donors (l-aspartate and l-glutamate) and ac- ceptors (a- ketoglutarate and oxaloacetate) ... mML-aspartate was used as amino donor for a- ketoglutarate, and 30 m ML-gluta- mate was used as amino donor for oxaloacetate. The activity of a- ketoglutarate was adj...

Ngày tải lên: 14/03/2014, 23:20

... Cloning, expression and characterization of a family-74 xyloglucanase from Thermobifida fusca Diana C. Irwin, Mark Cheng*, Bosong Xiang†, Jocelyn K. C. Rose‡ and David B. Wilson Department of ... Xeg74 was cloned into pET26b using the T. fusca Cel 6A signal sequence (MRMSPRPLRALL GAAAAALVSAAALAFPSQAA) in place of its native signal sequence. Cel 6A, Cel6Acd, and...

Ngày tải lên: 23/03/2014, 21:20

... sulfate fraction; lane 4, recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers ... b-lactoglobulin A, pI 5.1; myoglobin, pI 6.8/7.2; trypsinogen, pI 9.3. The pI of NaoA was determined from a standard curve of pI and migration distance (cm) of protein standards. E...

Ngày tải lên: 31/03/2014, 08:20

... 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢.ThethirdPCRwas carried ... proliferation assay We next analyzed the ability of recombinant SSA to stimulate human T-cells. All SSA preparations yielded Fig. 1. SDS/PAGE and immunoblot...

Ngày tải lên: 07/03/2014, 16:20

... Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii Maghil Denis, P. D. Mercy Palatty, N. Renuka Bai and S. Jeya Suriya Department ... sialidasetypeX,protease enzymes and molecular mass standards were purchased from Sigma. Preparation of crab sera Freshwater field crabs, Paratelphusa jacquemont...

Ngày tải lên: 21/02/2014, 00:20

... with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... of AF499 was identified as an archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence ()35 to )...

Ngày tải lên: 21/02/2014, 03:20

... bp was produced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose ... DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢. One strand...

Ngày tải lên: 07/03/2014, 11:20

... 25–29. 12 Kawakami R, Sakuraba H, Kamohara S, Goda S, Kawarabayasi Y & Ohshima T (2004) Oxidative stress response in an anaerobic hyperthermophilic archaeon: presence of a functional peroxiredoxin ... the first of all Prxs analysed so far in archaea that has only one cysteine residue in the sequence. Transcriptional analysis of bcp2 under oxidative stress and characterization...

Ngày tải lên: 07/03/2014, 12:20

... Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the assassin bug, Triatoma infestans Akihiro Morita 1 , Haruhiko Isawa 2 , ... Western blot analysis of triplatin-1 and -2 from the salivary gland of T. infestans. Extracts from a pair of salivary glands, recom- binant triplatin-1 and recombin...

Ngày tải lên: 30/03/2014, 10:20

... Ishikara, T. & Fukagawa, Y. (1980) Deacetylation of PS-5, a new beta-lactam compound III. Enzymological char- acterization of L -amino acid acylase and D -amino acid acylase from Pseudomonas ... xylosoxydans A- 6 N-acyl- D -glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl– D -amino acid amidohydrolase; V. paradoxus Iso1: Variovorax paradoxus...

Ngày tải lên: 08/03/2014, 16:20