Báo cáo khoa học: Membrane targeting of a folded and cofactor-containing protein potx
... RRfiKK exchange was achieved using the primers 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ATG-3¢ using the QuikChange kit (Stratagene) ... signal peptide of preHiPIP was mutated to KK using the primer couples 5¢-AAGAGC AAGAAAGACGCTGTCAAAGTGATG-3¢/5¢-TCCGG ATATAGTTCCTCCT-3¢ and 5¢-ACGTTACTGGTTTC ACATTC-3¢/5¢-AGCGTCTTTCTTGCTCTT...
Ngày tải lên: 23/03/2014, 21:20
... Anandatheerthavarada and Narayan G. Avadhani Department of Animal Biology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USA Cytochrome P450s (CYPs) belong to a ... Anandatheerthavarada HK, Addya S, Pandak W & Avadhani NG (1999) Dual targeting property of the N-terminal signal sequence of P450 1A1 . Targeting of heterologous proteins to e...
Ngày tải lên: 18/02/2014, 16:20
... plasma membrane potential and then be further accumulated within the mitochondria due to the mitochondrial membrane potential [11]. From the known plasma and mitochondrial membrane potentials and ... alkyla- tion leading to a depletion of mtDNA in intact cells (Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating reagent...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khóa học: Membrane transport of fatty acylcarnitine and free L-carnitine by rat liver microsomes pot
... enzymes such as DGAT, ACAT and AEAT are generated by a malonyl-CoA-insensitive carnitine acyltransferase (CAT) that is localized in the ER lumen [18,19]. It has been envisaged that the substrate for this ... fatty acyl-CoA substrate for AEAT, DGAT and ACAT in the ER lumen. Ó FEBS 2004 Transport of carnitine and acylcarnitine (Eur. J. Biochem. 271) 955 we found that alamethicin aboli...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: "Unsupervised Learning of Narrative Schemas and their Participants" potx
... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 602–610, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP Unsupervised Learning of Narrative Schemas and ... narrative schema model. 2.1 Narrative Event Chains Narrative Event Chains are partially ordered sets of events that all involve the same shared par- ticipant, the protagoni...
Ngày tải lên: 23/03/2014, 16:21
Tài liệu Báo cáo khoa học: Membrane targeting and pore formation by the type III secretion system translocon pdf
... 213–222. 66 Hamaguchi M, Hamada D, Suzuki KN, Sakata I & Yanagihara I (2008) Molecular basis of actin reorgani- zation promoted by binding of enterohaemorrhagic Escherichia coli EspB to alpha-catenin. ... Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E. coli effector EspB facilitates microvillus effacing and...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Structure and function of a regulated archaeal triosephosphate isomerase adapted to high temperature. J Mol Biol 342, 861–875. 12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S, Balaram H, Balaram ... in enzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... M, Hasegawa K, Horita C & Akera S (1999) A new matrix protein family related to the nacreous layer formation of Pinctada fucata. FEBS Lett 462, 225–229. 5 Kono M, Hayashi N & Samata T ... by invertebrates, and has three crystal phases: calcite, ara- gonite and vaterite. Although calcite is the most stable crystal thermodynamically, many organisms can form metastable aragonit...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... absorption bands. Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The spectral features of the final reaction mixture were analo...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... smaller compound PEA (Fig. 1B) and a water molecule are present and PEX and PEA refined satisfactorily with occupancies of 0.7 Table 1. Data and refinement statistics. Values in parentheses pertain ... 25% of the accessible surface area of a monomer contributes to Ll PDH dimer formation. Whereas LlPDH and OaPDH have a buried surface area of 5500 A ˚ 2 , TbPDH has a...
Ngày tải lên: 19/02/2014, 05:20