Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
... The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit Gene Regulation Laboratory, ... demonstrated a direct involvement of the )148 to )124 region of c-jun in its transcription and its interaction with positive regulatory factor (RLjunRP) in normal rat liver. The positive regulatory ... to maintain its DNA-bindingdomain in an active conformation.RLjunRP is an 40 kDa protein that forms an 80-kDaprotein–DNA adduct To assess approximate molecular mass of the factorsinteracting...
- 9
- 449
- 0
Báo cáo khoa học: The N-terminal cysteine pair of yeast sulfhydryl oxidase Erv1p is essential for in vivo activity and interacts with the primary redox centre doc
... (for-ward 5¢-CTTTGAAAAATATATCAGAGAAAATG-3¢/reverse 5¢-TCTTTAGCAGACCAGTTGTAAGG-3¢),C159S (forward 5¢-GCCCACAATAAAGTCAATAAGAAAT-3¢/reverse 5¢-CTCAGACATCCACCTCCCAAGTTCTT-3¢),C176S(forward5¢-CTCCAATTTCTGGGAAAAAAGATGGAAG- ... doi:10.1046/j.1432-1033.2003.03519.xGTTTGCCATCTTCG-3¢), C33 (forward 5¢-CTACTTGACTTTCAGTACGTGACC-3¢/reverse 5¢-GGTGGTAGATGATCGGCAAGGTTTGC-3¢), C130S (forward 5¢-CCAATTGGTGTGCTAAAGACTTTG-3¢/reverse 5¢-AAGGATAAATATGTGAGAAGATATTC-3¢), ... changes upon cysteine exchange are the blackappearance of the C30S protein and the orange colour of the C130S mutant. Changing the other cysteine within thesepairs did not result in matching...
- 8
- 405
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... Forward (nt 1552–1585 PAI-2)SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)SJS262 AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... plasminogen activator and urokinase-type plasminogen activator are controlled byplasminogen activator inhibitor types 1 and 2 (PAI-1 and PAI-2, respectively). One of the enigmatic features of ... transfectionefficiency within samples and the plates were returned to the incubator for further incubation. In vitro transcription and RNase protection assay and northern hybridization A cDNA library prepared with...
- 14
- 635
- 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx
... In the absence of any cysteine in the C-terminal region of rat AChE, we obtained mainlymonomers, with a small proportion of tetramers, asreported previously in the case of human AChE [39] and rat ... the formation of intercatenary disulfide bonds by cysteineresidues located at the end of the catalytic domain of rat AChETor at the beginning of its t peptide, in the ) 5to6 interval; in these mutants, the ... 21 and 22 wouldbring the N-terminal and C-terminal ends into closeproximity. To obtain information on the articulation between the catalytic domain and the t peptide, we analyzed the formation...
- 15
- 333
- 0
Báo cáo khoa học: Interaction of an 40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf
... inducible factor interacts with R LjunRP bound to the )148 to )124 region, and further enhances c-jun transcription in proliferating liver. Most of the studies to gain an insight into the transcrip-tional ... formationbetween factor( s) present in normal and regenerating rat liver with the )148 to )124 region of c-jun In order to establish w hether the factors p resent in rRNE-dbind to the )148 to )124 ... in resting and proliferating liver, and its implication on e nhanced c-jun expression in re generating rat liver. Materials and methodsAnimals and partial hepatectomyHealthy female inbred rats...
- 11
- 438
- 0
Tài liệu Báo cáo khoa học: "THE EFFEC TO FEST ABLISHING COHERENCE ELLIPSIS AND ANAPHORA RESOLUTION" pdf
... ] In these cases, the strict reading is readily available and perhaps preferred. Again, there appears to be a syntactic dependency in the parallel cases that is absent from the non-parallel ... Garvey and A. Caramazza. Implicit causality in verbs. Lin- guistic Inquiry, 5:549-564, 1974. (Garvey et al., 1976) C. Garvey, A. Caramazza, and J. Yates. Factors underlying assignment of ... and a match- ing grant for the latter from the Xerox Corporation. I would like to thank Mary Dalrymple, Barbara Grosz, Shalom Lappin, Karen Lochbaum, Christine Nakatani, Stuart Shieber, and...
- 8
- 414
- 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
... perturbed intra- and interchainbonds.After 180 min denaturation with 6 m urea and 0.2 mm b-mercaptoethanol, the A- chain was released and the the native enzyme form disappeared for bothWT and mutant ... and B-chains In WT thrombin, the A- chain assumes an overallboomerang-like shape interacting with the B-chain sur-face opposite to the active site [17]. Stabilization within the A- chain and between ... of the initial intensity and was alwaystaken into consideration in the analysis of the titrationdata.Computational methodsgromacs 3.2.1 software [22], running on a Linux PC clus-ter, was...
- 11
- 553
- 0
Báo cáo khoa học: The antibody to GD3 ganglioside, R24, is rapidly endocytosed and recycled to the plasma membrane via the endocytic recycling compartment ppt
... °C, and then the temperature was changed again to 4 °C. The cell surface was then stripped of any remain-ing antibody with acid wash. At this point, cells onlycontained R24 in intracellular ... °C, and then the temperature was shifted again to 4 °C. The cell sur-face was then stripped of any remaining antibody with acid wash(0 min). Cells were then incubated at 37 °C to restore intracellulartransport, ... functional association of glycolipid N-acetyl-galactosaminyl and galactosyl transferases in the Golgiapparatus. Proc Natl Acad Sci USA 98, 1625–1630.7 Crespo PM, Iglesias-Bartolome R & Daniotti...
- 15
- 329
- 0
Báo cáo khoa học: " THE KEY TO THE SELECTION PROBLEM IN NATURAL LANGUAGE GENERATION" ppt
... ordering, rather than a numeric value) to each object as a 130 natural and automatic part of the process of perceiving and organizing the scene. Intuitively the salience of an object is based ... problem", and it has been approached in various ways in the past: Direct translation generators such as [Swartout 1981, Clancey to appear] avoid the problem by leaving the decision to the original ... been based: the old term has often connoted a view of communication as a process of translating a data structure in the speaker's head into language and then reconstructing it in the audience's...
- 7
- 374
- 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... used as an artifi-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography and the bottom panel ... Yonezawa M, Maruyama K, Yamaguchi-Shino-zaki K & Shinozaki K (2007) The mitogen-activatedprotein kinase cascade MKK3-MPK6 is an importantpart of the jasmonate signal transduction pathway in Arabidopsis. ... [7]. In tomato, PTI1 can physically interact with the serine ⁄ threonine kinase PTO, which confersresistance to the bacterial pathogen P. syringae pvtomato carrying the avirulence effector proteins...
- 11
- 700
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ