Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt

... creased because of the addition of the link nodes in the grammar. 2 Constraint Grammar Dependency Instead of using context-free grammars, we are using a natural language framework based ... Research in the Development of a Spoken Language Understanding System using PARSEC* Carla B. Zoltowski School of Electrical Engineering Purdue Universi...

Ngày tải lên: 23/03/2014, 20:20

... According to the sequence obtained, the b-subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular ... xdhA gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc). Localization of xdhAB genes on the C. acidovorans plasmid was estab...

Ngày tải lên: 16/03/2014, 23:20

... execute commands. The main functions of ATLAS are the following : - Editing and updating of indexing charts : compi- lation of an external form of the chart, and modification of the internal form ... may be represented by associating questions to each node and the possible answers to the arcs coming from a node ; the leaves of the tree bear the name of...

Ngày tải lên: 17/03/2014, 19:21

... CH 3 -4-aminobutyrate and not 4-aminobutyrate was the substrate of the AO and thus both MABO and AO have the same substrate led us to postulate two pathways for the catabolism of CH 3 -4-aminobutyrate ... pro- duction in the assay was determined with the additions as indicat- ed. The presence of AO, SsaDH and CH 3 -4-aminobutyrate as substrate were required for maximal a...

Ngày tải lên: 19/02/2014, 07:20

... explained by changes in translation or maturation of the protein. An increase was also observed in the rate of degradation of the remaining mutant protein (20% left of the protein) vs. the wild type ... for the ligand-activated and nonactivated Ga q . Adding new media containing 10 lm carbachol every 30 min during the chase period did not have any effect on the rat...

Ngày tải lên: 20/02/2014, 03:20

... in Table 2, there was a marked difference in the total cell ATP synthesis as well as mitochondrial respiration-coupled ATP synthesis in macrophages and PC12 cells. The rate of ATP synthesis in ... migration, the slow migrating complex may be a dimmer and the faster migrating complex migrating with an apparent molecular mass of 200 kDa may be the monomeric form. It is...

Ngày tải lên: 20/02/2014, 23:20

... is a function of the information gained by giving a joint descrip- tion of a and b in terms of what they have in com- mon, compared to describing a and b separately. The relevant data in the ... similar). We use the information contained in the SketchEngine database 1 (Kilgarriff, 2003), a largescale implementation of Lin’s theory based on the BNC, which...

Ngày tải lên: 17/03/2014, 04:20

... classifications based on semantic and pragmatic codes in LDOCE, and examples in LDOCE can help to obtain such theories. 3. Formation of the context layer: the unification of the base layer ... supported in paxt by CRL. Some of the ideas were developed during my stay in CS/Fudan and CMT/CMU. 1The words passine/'acti~e are used to indicate dif- ferent leve...

Ngày tải lên: 17/03/2014, 08:20

... We have found that this actin-binding protein is a new substrate of calpain 1 separating the core domain, able to bind actin and the N-terminal domain which supports the protein regulation (calcium ... signal-regulated kinase and activation of the protease in the absence of calcium [34,35]. On the other hand, calpain inactivation can be achieved when calpain 2 is phospho...

Ngày tải lên: 23/03/2014, 10:21

... language (SL) has more that one translation into the target language (TL). Lexical gaps occur when a word in one language can not be trans- lated directly into another language. This latter prob- ... some as the key translation problem, (Kameyama et al., 1991). A case in point is the translation of prepositional phrases (PP). The following entry for the trans...

Ngày tải lên: 23/03/2014, 20:20