Báo cáo khoa học: "RESOLVING A PRAGMATIC PREPOSITIONAL PHRASE ATTACHMENT AMBIGUITY" pptx
... RESOLVING A PRAGMATIC PREPOSITIONAL PHRASE ATTACHMENT AMBIGUITY Christine H. Nal~tani Department of Computer and Information Science, University of Pennsylvania, Philadelphia, PA 19104 emaih nakatani@linc.cis.upenn.edu ... cannot be computed a priori, so pragmatic PP -attachment ambiguities are among those that defy structural and lexical rules for disambiguation. Anoth...
Ngày tải lên: 23/03/2014, 20:20
... TELEGRAM: A GRAMMAR FORMALISM FOR LANGUAGE PLANNING Douglas E. Appelt Artificial Intelligence Center SRI International Menlo Park, California O. Abstract Planning provides the basis for a ... example illustrates how a language system can use an annotated unification gramar like TELEGRAM. Suppose that there are two agents operating in an equipment as- sembly domain, and that...
Ngày tải lên: 31/03/2014, 17:20
... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction Type II transmembrane serine proteases (TT...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... (Hartmann Analytic, Braunschweig, Germany) was added. The supernatants were extracted with XAD16 resin after an additional 2 days of growth. The dried eluate was dissolved...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Resolving the native conformation ofEscherichia coli OmpA docx
... fragments of M-OmpA and I-OmpA displayed a band at a molecular mass of 7 kDa (Fig. 2A, lanes 1 and 2), identified by N-terminal sequencing as frag- ment 264–325 (6.6 kDa). A western blot of a ... pellet was discarded, and the supernatant, containing soluble OmpA, was loaded onto a column of Sephacryl S-300 (1.6 · 60 cm, HiPrep; GE Healthcare, Piscataway, NJ, USA) that had been equi...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mi...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis ... 40760–40767. 34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S (1999) TRAIL causes cleavage of bid by caspase-8 and loss of mitochondrial membrane potential resulting in apoptosis in BJAB...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx
... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... Biotechnology) and acetylated H3 (Upstate Bio- technology), and antibodies against specific modifications such as acetylated H3-K9 (Cell Signaling Technology) and H3-K14 (Abcam) and anti-H3 C-...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx
... corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker Vera Sheinman The Japan Institute for Educational Measurement Inc. 3-2-4 Kita-Aoyama, Tokyo, ... Lee and Seneff, 2008; Nagata et al., 2004; Nagata et al., 2005; Nagata et al., 2006; Tetreault et al., 2010b). This is one of the most active research areas in natural language processin...
Ngày tải lên: 20/02/2014, 04:20