Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

... A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context Masaaki NAGATA NTT Cyber Space Laboratories 1-1 Hikari-no-oka Yokosuka-Shi ... katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hirag...

Ngày tải lên: 23/03/2014, 19:20

... (a gift from G. E. O. Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer 4 (5¢-GCTCTAGAGCTTCAC GGATGCATTATCGATGGGCTC-3¢). ... RNA PCR Core kit from Perkin Elmer (Roche) and primers 11 (5¢-CTAGCTAGCATGACAGA GTTACCTGCACC-3¢ )and1 2(5¢-ATAGTTTAGCG GCCGCTAGATATAAAATTGATGGAATGC-3¢)were used to amplify p...

Ngày tải lên: 08/03/2014, 08:20

... Morphologically Rich Languages in a Poor Resource Scenario Sandipan Dandapat, Sudeshna Sarkar, Anupam Basu Department of Computer Science and Engineering Indian Institute of Technology Kharagpur ... 20K and 40K words) of the training data to understand the relative perform- ance of the models as we keep on increasing the size of the annotated data. 3.1 Training Data T...

Ngày tải lên: 31/03/2014, 01:20

... recording and labeling of large cor- pora of speech, making it useful for speech and linguistic research, and it provides imme- diate feedback on pronunciation, thus making it useful as a clinical ... rerecord an unacceptable utterance. Recordings are automatically labeled and saved and a speech database is created from these recordings. The system’s intention is...

Ngày tải lên: 20/02/2014, 09:20

... Existing Approaches There are a number of approaches to derive syntactic categories. All of them employ a syntactic version of Harris’ distributional hypothesis: Words of similar parts of speech ... statistical dependence on 5% level), and at least four shared neighbours of A and B on each side. Only words with a frequency rank higher than 2,000 are take...

Ngày tải lên: 17/03/2014, 04:20

... that we have access to parallel data with a resource-rich language. This scenario is applicable to a large set of languages and has been considered by a number of authors in the past (Al- shawi ... learning approaches have advanced the state -of- the-art on a variety of tasks in natural lan- guage processing, resulting in highly accurate sys- tems. Supervised part- of- spee...

Ngày tải lên: 30/03/2014, 21:20

... Predicting Part- of- Speech Information about Unknown Words using Statistical Methods Scott M. Thede Purdue University West Lafayette, IN 47907 Abstract This paper examines the feasibility of using ... feasibility of using sta- tistical methods to train a part- of- speech pre- dictor for unknown words. By using statistical methods, without incorpora...

Ngày tải lên: 31/03/2014, 04:20

... B56, and PR72-type B subunits in organisms as diverse as Neurospora crassa, Candida tropicalis, Dictyostelium discoideum, Medicago varia (alfalfa), Arabidopsis t haliana, Oryza sativa (rice), Caenorhabditis ... [buffer A containing 0.1% nonidet p40 (NP-40) and 0.25% BSA] and 20 lLofapre- washed 1 : 1 slurry of glutathione±Sepharose (Amersham Pharmacia) was added. Incubation continue...

Ngày tải lên: 08/03/2014, 10:20

... anti-HA TIAR-flag BOIP-flag HA-hnRNP M RNaseA WB anti-flag WB anti-HA HA TIAR Merged DAPI TIAR-flag BOIP-flag HA-DDX21 RNaseA WB anti-flag WB anti-HA B HA-ASF/SF2 HA-p68 HA-hnRNP M HA-DDX21 Fig. 2. (A) Analysis of the identified ... Laboratories; Invitrogen), goat anti- TIAR C18 and anti-eiF3b (Santa Cruz Biotechnology, Santa Cruz, CA, USA) sera; at a dilution of 1 : 5000 for mouse a...

Ngày tải lên: 16/02/2014, 15:20

... cold-, drought- and ABA-regulated gene expression. Plant Mol Biol 24, 701–713. 15 Prabakaran P, An J, Gromiha M, Selvaraj S, Uedaira H, Kono H & Sarai A (2001) Thermodynamic database for protein-nucleic ... were aligned computationally and the appearance of a base at each position in a motif was presented as a percentage fre- quency of all four kinds of base. The base...

Ngày tải lên: 18/02/2014, 13:20