Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

Báo cáo khoa học: "Compounding and derivational morphology in a finite-state setting" pptx

... linguistic information will be available to address derivation/compounding. Since the nec- essary generative capacity is available in the syntac- tic grammar anyway, it seems reasonable to leave more ... Compounding and derivational morphology in a finite-state setting Jonas Kuhn Department of Linguistics The University of Texas at Austin 1 University Station, B5100 Austin, TX...

Ngày tải lên: 23/03/2014, 19:20

8 353 0
Báo cáo khoa học: "LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR" pdf

Báo cáo khoa học: "LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR" pdf

... "the' and "bucket' for (1, 'bury', 'the' and 'hatchet' for ¢2, and 'take', 'into' and 'account' for ,t3. The idiomatic ... LEXICAL AND SYNTACTIC RULES IN A TREE ADJOINING GRAMMAR Anne Abeill6* LADL and UFRL University of Paris 7-Jussieu abeille@zeta.ibp.fr ABSTRACT according to this defini...

Ngày tải lên: 31/03/2014, 18:20

7 472 0
Báo cáo khoa học: "PARSING AND DERIVATIONAL EQUIVALENCE" pptx

Báo cáo khoa học: "PARSING AND DERIVATIONAL EQUIVALENCE" pptx

... and suggestions in relation to this material, and Inge Bethke and Henk Zee- vat for reading a late draft. All errors are our own. The work was carried out by the alphabetically first author ... kind in a grammar undermines a methodological assump- tion of derivational uniqueness. Combinatory Logic and Combina- tory Grammar Combinatory logic (CL; Curry and Fey...

Ngày tải lên: 24/03/2014, 05:21

9 341 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. European Patent Application No. EP080113 1A1 . 21 Abendroth J, ... evolution and structural analysis of N-carbamoyl-d-amino acid amidohydrolase provide insights into recombinant Y. Cai et al. A novel high-activity D-hydantoinase from Jannaschia sp....

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... enterica Typhimurum strain IFO12529 genomic DNA as the template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing ... pro- tein is made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 Structure of Salmonella typhimurium SurE A. Pappachan et al. 585...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... puri- fied, and annealed. The Not1 site in the resulting gene was removed using the complementary oligomers 5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3¢ (forward) and...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: "Models and Training for Unsupervised Preposition Sense Disambiguation" pptx

Tài liệu Báo cáo khoa học: "Models and Training for Unsupervised Preposition Sense Disambiguation" pptx

... corpus was chosen as a starting point for our study since it allows a comparison with the original SemEval task. We plan to use larger amounts of additional training data. We used an in- house ... Linguistics Models and Training for Unsupervised Preposition Sense Disambiguation Dirk Hovy and Ashish Vaswani and Stephen Tratz and David Chiang and Eduard Hovy Information Sciences...

Ngày tải lên: 20/02/2014, 05:20

6 437 0
Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt

Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt

... on Computational Linguistics (COLING’10), Beijing, China. Alexandru Ceaus¸u, John Tinsley, Jian Zhang, and Andy Way. 2011. Experiments on domain adap- tation for patent machine translation in the ... Ueffing, Gholamreza Haffari, and Anoop Sarkar. 2007. Transductive learning for statistical machine translation. In Proceedings of the 45th An- nual Meeting of the Association of Computatio...

Ngày tải lên: 22/02/2014, 03:20

11 436 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... Cryphonectria parasitica [9] and in the biosynthesis of cinnabarinic acid, a fungal metabolite produced by Pycnoporus cinnabarinus that exhibits anti- microbial activity against various bacterial species ... °Cfor20s,52°Cfor20s and 70 °C for 2 min; then a final extension at 72 °C for 10 min. The primers for lac1 P LAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢)andP LAC1R (5¢-AACGAG CTCAAGTACAAA...

Ngày tải lên: 07/03/2014, 15:20

11 703 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... target). Zebrafish maintenance and preparation of eggs TAB zebrafish were reared and maintained on a light ⁄ dark cycle essentially as described by Westerfield [49]. All experi- ments and fish maintenance ... JQ & Martindale MQ (1996) Dual origins of mesoderm in a basal spiralian: cell lineage analyses in the polyclad turbellarian Hoploplana inqui- lina. Dev Biol 179, 329–338. 4...

Ngày tải lên: 07/03/2014, 21:20

17 509 0
w