Báo cáo khoa học: "User Expertise Modelling and Adaptivity in a Speech-based E-mail System" doc

... User Expertise Modelling and Adaptivity in a Speech-based E-mail System Kristiina JOKINEN University of Helsinki and University of Art and Design Helsinki Hämeentie 135C 00560 Helsinki ... disfluencies and facilitating more natural interaction (e.g. Danieli and Gerbino, 1995; Litman and Pan, 1999; Krahmer et al, 1999; Walker et al, 2000). In the AthosMail...

Ngày tải lên: 23/03/2014, 19:20

... approach can be applied in a compositional grammar, in an insightful and linguistically moti- vated way. Lack of control on rule applications In many cases the grammar writer has a certain ... i.e. 'Subgrammars and Rule Classes in the Rosetta Translation System' by Appelo and Fellinger and 'Controlled M-Grammars in the Rosetta System' by Landsbe...

Ngày tải lên: 22/02/2014, 10:20

... increase in malonyl-CoA promotes a decrease in neuropeptide Y and agouti related peptide in hypo- thalamic malonyl-CoA while promoting an increase in proopiomelanocortin and cocaine and amphetamine regulated ... [41–45]. There are at least six carnitine acyltransferases in mammals [46]. Carnitine acetyltransferase and carni- tine octonyltransferase mediate the transfer of...

Ngày tải lên: 14/02/2014, 22:20

... extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8, 528–535. 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M ... Gagne ´ M & Rappe ´ AK (1998) p-Stacking interactions. Alive and well in proteins. J Biol Chem 273, 15458–15463. 29 Kashiwagi T, Jeanteur D, Haruki M, Katayanagi M, Kanaya S & Mor...

Ngày tải lên: 18/02/2014, 13:20

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas, D. melanogaster-2 and D. melanogaster-3 sequences (data not shown). By contrast, R. pachyptila amino acid ... GTT ACT TCC GCA GCT AGG 466–483 Probe amplification for FISH RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAtrFprobe TAC AAA GAT CCA ATC CAG C 616–...

Ngày tải lên: 18/02/2014, 16:20

... identified an upstream regulator of MAPK cascades, mitogen-activated protein kinase kinase kinase 7 interacting protein 2 (TAK 1 binding protein 2 ¼ TAB 2), as an IEG during hyperosmotic stress in tilapia ... compilation ª 2007 FEBS Tilapia CaSR senses changes in external [Ca 2+ ] and activates phospholipase C and mitogen-activated pro- tein kinase (MAPK) signaling [14]. Moreover, chan...

Ngày tải lên: 18/02/2014, 16:20

... contains 21 proteins involved in mRNA binding. The 50S, or L, subunit contains 34 proteins, binds to tRNA, and mediates peptidyl trans- fer. Shown in Fig. 4A is the base peak chromatogram from a ... using CAD. In addition, coupling nanoflow LC with our ETD technology increases the sensitivity of intact protein analyses, and with ongoing advance- ments in protein chromatographic...

Ngày tải lên: 18/02/2014, 16:20

... vector] as 5¢-primer and 5¢-TCTCCGTAGG GGAGACAAAAGT-3¢,5¢-ATCCCGCGGGGGAAACCT CATC-3¢ and 5¢-CTGTTTGGAC GAACGCAAGATG-3¢ as 3¢-primers for C53S, C175S and W88F variants, respec- tively (mutated codons ... peroxiredoxin Martin Aran 1 , Daniel Caporaletti 1 , Alejandro M. Senn 1 , Marı a T. Tellez de In ˜ on 2 , Marı a R. Girotti 1 , Andrea S. Llera 1 and Ricardo A. Wolosiuk 1 1 In...

Ngày tải lên: 18/02/2014, 17:20

... limited and this may result in the accumulation of arabitol [16]. Alternative pathways for bacterial l-arabinose metabo- lism, involving an l-arabinose 1-dehydrogenase, are known but appear to ... biochemical data, a strong correlation between l-arabinose and d-xylose utiliza- tion in yeasts was observed a long time ago [22], already pointing to a partial overlap between the cat...

Ngày tải lên: 19/02/2014, 00:20

... 5¢-GATATG CAGGTC AACAGGAACCGCGCCAATGGCGCA ACC-3¢. The template used for amplification was the pKK233-2 plasmid containing Enterobacter cloacae MurA wild-type (for generation of the R120K single ... the data obtained at this temperature was not included in the analysis. The raw data were integrated and normal- ized for molar concentration. The dissociation constants, K d values, enthalpies...

Ngày tải lên: 19/02/2014, 13:20