Báo cáo khoa học: "Collapsed Consonant and Vowel Models: New Approaches for English-Persian Transliteration and Back-Transliteration" ppt

... the Rouge family allow for skip n-grams (Lin and Och, 2004a); Kauchak and Barzilay (2006) take para- phrasing into account; metrics such as METEOR (Banerjee and Lavie, 2005) and GTM (Melamed et al., ... three standard automatic metrics: BLEU, METEOR, which incorporates recall and stemming, and HWCM, which uses syntax. BLEU is smoothed to be more appropriate for sentence- level...

Ngày tải lên: 08/03/2014, 02:21

... Association for Computational Linguistics Collapsed Consonant and Vowel Models: New Approaches for English-Persian Transliteration and Back -Transliteration Sarvnaz Karimi Falk Scholer Andrew Turpin School ... association. Coving- ton considers consonant to consonant and vowel to vowel correspondence more valid than consonant to vowel. Kang and Choi (2000...

Ngày tải lên: 23/03/2014, 18:20

... to effective physical and water barrier formation. Upon CE formation in keratinocytes and hair follicle cells, TGase 3 cross-links various substrate proteins such as SPRs, involucrin, loricrin and trichohyalin ... closed circles represent the reactions for pepK5, pepT26 and pepF11 in each isozyme reaction. The closed and open rectangles indicate the reaction for pepE51 and pep...

Ngày tải lên: 29/03/2014, 21:20

... causes for this limitation: (1) the direct projection approach considers only align- ments between entity candidates, and it does not consider any contextual information; and, (2) it is performed ... extractor f s for a resource-rich source language L s and a par- allel corpus of L s and L t . Figure 1 shows an exam- ple of annotation projection for relation extraction with a bi-...

Ngày tải lên: 23/03/2014, 14:20

... over the first experiment by 2.8% and 3.2% for structural and labelled accuracy respectively. We see that the introduction of stochastical in- formation into the handwritten language model is generally ... data can only be guaranteed for the probabilistic components. On the other hand CoNLL restricted itself to the eas- ier attachment task and therefore provided the gold standard POS...

Ngày tải lên: 31/03/2014, 01:20

... ‘none’, and the mass error tolerances for precursor and fragment ions were typically set to 0.15 u for qTOF MS ⁄ MS and 50 p.p.m. and 1 u, respectively, for MALDI-TOF ⁄ TOF MS data. The formation ... Piperidine (20%) ⁄ dimethylformamide was the standard cleavage cocktail used for Fmoc detach- ment. The resins were treated twice for 10 min. All cou- plings were performed usin...

Ngày tải lên: 16/02/2014, 14:20

... dominated by eight b-strands and a twelve residue C-terminal a-helix. The b-strands are arranged as a sheet formed by a five-stranded twisted antiparal- lel sheet plus a small three-stranded antiparallel ... these two chromosomal systems and pem ⁄ parD and, together with structural information on free or bound toxin and antitoxin pro- teins obtained by X-ray crystallography and NMR sp...

Ngày tải lên: 18/02/2014, 04:20

... status and ⁄ or the affinity of each DBD for nGAAn changes under stress conditions is not known. The activation domains at the amino- and carboxy-termini are required for the transient and sustained ... is indispensable for binding of a single tri- mer to three-unit HSEs and for HSF hyperphosph- orylation, but HR-A ⁄ B is not required for binding HSEs with four or more units...

Ngày tải lên: 18/02/2014, 04:20

... gene family and the circadian clock Remco Nagel 1 , Linda Clijsters 1 and Reuven Agami 1,2 1 Division of Gene Regulation, The Netherlands Cancer Institute, Amsterdam, The Netherlands 2 Center for Biomedical ... sites for miR-192 or miR-194. Whereas the Per1 3¢UTR contains one predicted target site for miR-194, Per2 has a site for miR-192 as well as miR-194, and Per3 harbours one...

Ngày tải lên: 18/02/2014, 06:20

... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ ... to Dr Shaker Chuck Farah and Dr Carla Columbano de Oliveira for their helpful comments and Dr Marvin Wickens for providing t...

Ngày tải lên: 18/02/2014, 06:20