Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

... Anchored Learning is to add a unique feature a i (an anchor) to each training sample (we add as many new features to the model as there are training samples). These new features make our data ... SVM chunker on anchored data (as the anchored data is guaranteed to be linearly separable, we can set avery high value to the C parameter, preventing any mis- classification), and then i...

Ngày tải lên: 23/03/2014, 18:20

... 1: EAA's and SHDGA's Traversals of An Analysis Tree. 3. GENERALITY-WISE SUPERIORITY OF EAA OVER SHDGA The traversals by SHDGA and EAA as marked on the graph are stas. This means ... inefficiency and nondeterminism, and which EAA will handle in an efficient and deterministic manner. We also point out that only EAA allows to treat the underlying grammar in a tr...

Ngày tải lên: 31/03/2014, 06:20

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas, D. melanogaster-2 and D. melanogaster-3 sequences (data not shown). By contrast, R. pachyptila amino acid ... GTT ACT TCC GCA GCT AGG 466–483 Probe amplification for FISH RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAtrFprobe TAC AAA GAT CCA ATC CAG C 616–...

Ngày tải lên: 18/02/2014, 16:20

... contains 21 proteins involved in mRNA binding. The 50S, or L, subunit contains 34 proteins, binds to tRNA, and mediates peptidyl trans- fer. Shown in Fig. 4A is the base peak chromatogram from a ... using CAD. In addition, coupling nanoflow LC with our ETD technology increases the sensitivity of intact protein analyses, and with ongoing advance- ments in protein chromatographic...

Ngày tải lên: 18/02/2014, 16:20

... location of hydration heat sensor and image 3. Analysis of internal restraining stress for mat foundation 3.1 The amount of hydration heat and adiabatic temperature rise In hydration heat ... 7 the hydration heat was about 80℃ at center and about 67℃ at surface when it reached the highest point. And at that time temperature difference between internal and external area was 12.9...

Ngày tải lên: 07/03/2014, 03:20

... (without insu- lin and PDI) was equilibrated at 25 °C, and the NADPH oxidation rate was recorded against a reference cuvette con- taining NADPH, EDTA and buffer only. Subsequently, insulin was added, ... cPDI contains four thioredoxin domains and an acidic C-ter- minal tail (a, b, b¢, a and c). Two thioredoxin active sites (WCGHCK) are found in the a and a domains, respect...

Ngày tải lên: 07/03/2014, 05:20

... caldus variants have been detected in diverse locations such as acidic hot springs in Yellowstone National Park (WY, USA), acid mine drainage in Iron Mountain (CA, USA) [3] and exposed pyritic ores in ... chains that increased absorbance at 290 nm. In this study, the assay was used to monitor tetrathionate hydrolase activity in cell extracts during purification. Enzyme activity...

Ngày tải lên: 07/03/2014, 14:20

... the migration and invasion potential of CaOV-3 and OVCAR-3 ovarian cancer cells. The GnRH-induced increase in invasiveness and migratory activity was blocked by neutralizing antibodies against MMP-2 ... 5509 kinase-signaling pathways. Mol Endocrinol 12, 451– 457. 87 Yokoi T, Ohmichi M, Tasaka K, Kimura A, Kanda Y, Hayakawa J, Tahara M, Hisamoto K, Kurachi H & Murata Y (2000) Acti...

Ngày tải lên: 16/03/2014, 04:20

... n-3 PUFA ratio 2 from 2.1 in virgin gland to 1 in preg- nant gland, when individual PUFA content was ana- lyzed in the mammary gland, a significant increase in n-3 DPA and EPA in pregnant glands ... increase in n-3 docosa- pentaenoic acid (DPA) and eicosapentaenoic acid (EPA) in the mammary gland following pregnancy. Alternation of the n-6 ⁄ n-3 ratio in favor n-3 fatty a...

Ngày tải lên: 16/03/2014, 10:20

... C G ATGA acg-t c 480 Cc-CATH1 actgtcccctcgctgccttccatccaataaa ggtctttgctggtaaaaaaaaaaaaaaaa 531 Cc-CATH2 TTG-CTGAg-gaataaa -ggggc gtgtg c-accaagc -a 517 Cc-CATH3 g tc a cc c aataaa -c-g ttca-gct ... 397 Cc-CATH3 G T G GCCGGTGGC AC G GC G 420 Cc-CATH1 GGATACAACCTCTACCGGGCAATCAAGAGGAAGTGAgccgtccccagagctgctgtcacc 471 Cc-CATH2 T AGA-GGTC-G GCTT TC-CTA TCA-C-T-GCCG T-G CA-G-T 457 Cc-CATH3 CAT A...

Ngày tải lên: 28/03/2014, 23:20